Em formação

Bowtie: não é possível ler o arquivo fasta?

Bowtie: não é possível ler o arquivo fasta?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estou tentando usarbowtie2para analisar meus dados no formato FASTA, mas parece que esta versão não consegue ler meus dados corretamente. Minha linha de comando é a seguinte:

bowtie2 -x $ REFERENCE -f $ TARGET -S $ TARGET.sam

A versão 2 do Bowtie tem o seguinte:

Aviso: ignorando a leitura de 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' porque o comprimento (0) <= # sementes incompatíveis (0) Aviso: ignorando a leitura 'ORIGINAL: GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT' porque tinha <2 caracteres de comprimento GACTGTAGATGAT: SKIPGACTGACT 'lidoGTAGATCATTAT' porque tinha <2 caracteres de comprimento GACTGTAGAT: ORIGINALGACTGACTGACTGACT 'lido: GACTGACTGATGAT Aviso: GACTGACTGATGACT de comprimento GACTGTAGAT: IGINALGATGACTGATGACT longo: 0) <= # sementes incompatíveis (0)

Observe quegravata-borboleta(versão 1) está satisfeito com meu FASTA! Aqui está um trecho e o quegravata-borboletadiz:

> ORIGINAL: GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC GCTACGGAATAAAACCAGGAACAACAGACCCAGCAC> ORIGINAL: ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG ATTAACAACAAAGGGTAAAAGGCATCATGGCTTCAG> ORIGINAL: GCAGAAAATGGGAGTGAAAATCTCCGATGAGCAGCT AATGGGAGTGAAAATCTCCGATGAGCAGC # leituras processadas: 471409 # lê com pelo menos um relatado alinhamento: 464583 (98,55%) # lê que falhou para alinhar: 6826 (1,45%)

Agora estou perdido. Alguém pode ver o que estou fazendo de errado aqui? Posso confiar de qualquer maneirabowtie2quando termina e mostra quantas sequências estão alinhadas?

Obrigado!


Visto que aparentemente não tenho reputação suficiente para comentar, postarei isso como uma resposta e deixarei alguém mexer.

Em primeiro lugar, tente garantir que a ordem dos argumentos está correta. Você deveria estar digitandobowtie2 -f -x $ TARGET -U $ TARGET -S $ TARGET.sam, uma vez que o bowtie2 (como com muitos outros programas) pode ser um pouco exigente quanto à ordem dos argumentos.

Em segundo lugar, geralmente é aconselhável que a entrada de exemplo inclua as linhas que estão causando o problema (visto que aparentemente não está reclamando das linhas que você postou, podemos apenas presumir que as está alinhando).

Em terceiro lugar, você normalmente só obterá esses avisos se eles forem verdadeiros. Por exemplo, se você fossegrep -A 1 -w GACACTGTTCATGCTGGTGTCGCTGTCGGGCATTAT $ targetentão, meu palpite é que você descobrirá que não há sequência restante. Presumivelmente, eles são o resultado de seus adaptadores de corte ou algo parecido, então faça com que seu cortador descarte resultados realmente curtos (eles não se alinham de forma significativa de qualquer maneira).


Alinhando as leituras com o transcriptoma

Armado com o arquivo fasta agrupado e as leituras brutas aparadas, agora você pode determinar as ocorrências de leitura por transcrição.

As funções de alinhamento são suportadas na plataforma Trinity, incorporando assim o uso dessas ferramentas de terceiros, desde que estejam instaladas. O software instalado necessário inclui Bowtie (usei v1.1.2) e SAMtools (v1.2) para fornecer saídas de arquivos bam. Também é necessário o Perl e, claro, o Trinity & # 8211 se estiver executando dentro dos utilitários simplificados.

#PBS -P nome do projeto
#PBS -N AP0_alignment
#PBS -l nodes = 1: ppn = 20
#PBS -l walltime = 20: 00: 00
#PBS -l pmem = 24gb
#PBS -e ./AP0_alignment.txt
#PBS -M [email protected]
#PBS -m abe

# Carregar módulos
módulo de carga perl
módulo de carregamento de gravata borboleta
módulo de carga java
módulo de carregamento de samtools / 1.2
módulo de carga trinity / 2.1.1

# Diretório de trabalho
cd / caminho para o diretório de trabalho

# Execute o script do bowtie
/usr/local/trinity/2.1.1/util/bowtie_PE_separate_then_join.pl & # 8211seqType fq
& # 8211left AP0_R1_pairwithunpair.trim.fq & # 8211right AP0_R2_pairwithunpair.trim.fq
& # 8211target Syzygium.fasta & # 8211aligner bowtie
& # 8212 -p 4 & # 8211all & # 8211best & # 8211strata -m 300

A partir daí será gerada uma pasta chamada bowtie contendo arquivos bam e bams indexados. Para a próxima etapa, você usará os arquivos bam de todas as amostras e todos os tempos para determinar as contagens por transcrição. Eu renomeio os arquivos bam de acordo com a planta / hora, por exemplo. AP0_coordSorted.bam e AP0_coordSorted.bam.bai


Versão 2.4.2 - 5 de outubro de 2020

  • Corrigido um problema que fazia com que o script do wrapper bowtie2 gerasse um erro ao usar argumentos específicos do wrapper.
  • Adicionada nova sinalização --sam-append-comment que acrescenta comentários de leitura FASTA / Q ao registro SAM correspondente.
  • Corrigido um problema que fazia com que qupto, -u transbordasse quando havia & gt = 2 32 sequências de consulta (PR # 312).
  • Corrigido um problema que fazia com que o script de construção do bowtie2 processasse incorretamente os arquivos de referência.

Trinity: O erro não consegue encontrar o caminho para bowtie2 # 452

O texto foi atualizado com sucesso, mas estes erros foram encontrados:

Kubu4 comentou em 24 de outubro de 2018

Não tenho certeza do que você colou aqui.

Você não deve ter tudo isso:

Kubu4 comentou em 24 de outubro de 2018

Onde está localizado o seu script? Eu não consigo encontrar.

Além disso, eu precisava dessa linha quando executei o Trinity pela última vez (não resolve o erro do bowtie, mas evita um problema com o Trinity mais tarde)

Kubu4 comentou em 24 de outubro de 2018

O erro bowtie2 ocorre porque bowtie2 não está atualmente em seu $ PATH. Isso significa que você provavelmente também terá que adicionar água-viva e salmão ao $ PATH.

Para fazer isso, adicione o seguinte texto ao seu

Grace-ac comentou em 24 de outubro de 2018

Sim, não tenho certeza do que estou fazendo!

Eu literalmente copiei e colei o script do TextWrangler em meu terminal enquanto estava conectado ao Mox.

. O que agora entendo não é o caminho a percorrer. Agora estou pensando em enviar o trabalho por meio do arquivo de script em vez de copiá-lo e colá-lo.

Kubu4 comentou em 24 de outubro de 2018

Correto, você não pode copiar e colar o script para executá-lo. O script deve estar no Mox e, em seguida, precisa de um comando especial para executá-lo, consulte o wiki do Mox.

Kubu4 comentou em 24 de outubro de 2018

Eu olhei para o script. Você precisa colocar o material PATH personalizado em seu

Kubu4 comentou em 24 de outubro de 2018

Além disso, depois de adicionar isso ao seu

./bashrc, você precisará originar o arquivo para que o computador encontre as novas informações:

arquivo /.bashrc. - Você está recebendo isto porque está inscrito neste tópico. Responda a este e-mail diretamente, visualize-o no GitHub ou ignore a conversa.

Grace-ac comentou em 24 de outubro de 2018

/.bashrc é a mesma coisa que o arquivo de script?

/.bashrc é a mesma coisa que o arquivo de script? - Você está recebendo isso porque comentou. Responda a este e-mail diretamente, visualize-o no GitHub ou ignore a conversa.

/.bashrc é a mesma coisa que o arquivo de script? - Você está recebendo isso porque comentou. Responda a este e-mail diretamente, visualize-o no GitHub ou ignore a conversa.

Kubu4 comentou em 25 de outubro de 2018

Esses programas precisam estar disponíveis no sistema $ PATH para que o Trinity seja executado. Caminhos absolutos ou relativos não têm direção, desde que os programas estejam disponíveis no sistema $ PATH.

Kubu4 comentou em 25 de outubro de 2018

Ou talvez aquele comando export PATH vai trabalhe em seu script SBATCH da maneira que você já fez. Hmmm.

Grace-ac comentou em 25 de outubro de 2018

bem, acho que vamos descobrir! acabou de começar a executar o trabalho no Mox

Kubu4 comentou em 25 de outubro de 2018

No entanto, percebi que você usará esta versão do Trinity:

Essa é uma versão bem antiga (2.40) e tem quase dois anos neste momento. Eu recomendo usar a versão mais recente:

No entanto, como você usará a versão antiga, não acho que realmente vá precisar desses programas em seu PATH. Acho que eles vieram junto com o Trinity naquela época.

Grace-ac comentou em 28 de outubro de 2018

Irá consertar a versão do Trinity no script e fazer novamente.

Há alguma outra coisa que devo consertar antes de enviar o trabalho novamente?

Grace-ac comentou em 28 de outubro de 2018

Oh, não li totalmente o erro corretamente. pensei que ele disse que não poderia executar o trinity porque não era a versão atualizada.

Vou verificar os arquivos fq e compará-los com a fonte!

Grace-ac comentou em 30 de outubro de 2018

Estes são os arquivos que eu tinha no script:

Estes são os arquivos que estão no trinity_out_dir:

Os números estão corretos nos nomes dos arquivos .fastq, mas não tenho certeza se as extensões adicionadas de ".PwU.qtrim.fq" significam que houve um problema.

Kubu4 comentou em 30 de outubro de 2018

mas provavelmente há problemas com seus arquivos fq

Por que você acha isso? Eu não estou entendendo.

Grace-ac comentou em 30 de outubro de 2018

os arquivos são de / nightingales / C_bairdi /. Baixei-os e depois carreguei-os no meu diretório de dados no mox.

Kubu4 comentou em 30 de outubro de 2018

MD5 é um programa que gera um código único (soma de verificação) para um arquivo. Transferir dados de um lugar para outro pode corromper um arquivo (arquivos maiores são mais propensos a serem corrompidos durante a transferência). Você pode usar a soma de verificação MD5 gerada originalmente para o arquivo para comparar a soma de verificação MD5 gerada depois que um arquivo é transferido. Se as somas de verificação corresponderem, significa que o arquivo transferido é exatamente o mesmo que o original. Se as somas de verificação não corresponderem, algo foi corrompido durante a transferência.

Portanto, sempre que copiar / mover qualquer arquivo FastQ, você deve comparar as somas de verificação.

Dica profissional: o uso do rsync para copiar arquivos, na verdade, possui essa funcionalidade integrada e fará isso automaticamente.


Bowtie 2 é uma ferramenta ultrarrápida e com uso eficiente de memória para alinhar leituras de sequenciamento a longas sequências de referência. É particularmente bom no alinhamento de leituras de cerca de 50 a 100 ou 1.000 caracteres, e particularmente bom no alinhamento de genomas relativamente longos (por exemplo, de mamíferos). Bowtie 2 indexa o genoma com um Índice FM para manter sua pegada de memória pequena: para o genoma humano, sua pegada de memória é normalmente em torno de 3,2 GB. O Bowtie 2 oferece suporte aos modos de alinhamento com intervalo, local e emparelhado.

Bowtie 2 está disponível em vários gerenciadores de pacotes, notavelmente Bioconda. Com o Bioconda instalado, você deve conseguir instalar o Bowtie 2 com o conda install bowtie2.

Versões em contêineres do Bowtie 2 também estão disponíveis por meio do projeto Biocontainers (por exemplo, via Docker Hub).

Você também pode baixar fontes e binários do Bowtie 2 na guia "releases" desta página. Binários estão disponíveis para Linux, Mac OS X e Windows. Ao utilizar o projeto SIMDE, o Bowtie 2 agora oferece suporte às seguintes arquiteturas: ARM64, PPC64 e s390x. Se você planeja compilar o Bowtie 2 por conta própria, certifique-se de ter pelo menos a biblioteca zlib e os arquivos de cabeçalho instalados. Consulte a seção Construindo a partir da fonte do manual para obter detalhes.

Quer experimentar o Bowtie 2? Confira a interface do Bowtie 2 (atualmente em beta).

bowtie2 pega um índice Bowtie 2 e um conjunto de arquivos de leitura de sequenciamento e produz um conjunto de alinhamentos no formato SAM.

"Alinhamento" é o processo pelo qual descobrimos como e onde as sequências lidas são semelhantes à sequência de referência. Um "alinhamento" é o resultado desse processo, especificamente: um alinhamento é uma forma de "alinhar" alguns ou todos os caracteres na leitura com alguns caracteres da referência de uma forma que revela como eles são semelhantes. Por exemplo:

Onde os símbolos de traço representam lacunas e as barras verticais mostram onde os caracteres alinhados coincidem.

Usamos o alinhamento para fazer um palpite sobre a origem de uma leitura em relação ao genoma de referência. Nem sempre é possível determinar isso com certeza. Por exemplo, se o genoma de referência contém vários trechos longos de As (AAAAAAAAA etc.) e a sequência de leitura é um trecho curto de As (AAAAAAA), não podemos saber com certeza exatamente onde no mar de As a leitura se originou.

bowtie2-build constrói um índice Bowtie a partir de um conjunto de sequências de DNA. bowtie2-build gera um conjunto de 6 arquivos com sufixos .1.bt2, .2.bt2, .3.bt2, .4.bt2, .rev.1.bt2 e .rev.2.bt2. No caso de um índice grande, esses sufixos terão uma terminação bt2l. Esses arquivos juntos constituem o índice: eles são tudo o que é necessário para alinhar as leituras a essa referência. Os arquivos FASTA da sequência original não são mais usados ​​pelo Bowtie 2 depois que o índice é criado.

O formato de índice .bt2 do Bowtie 2 é diferente do formato .ebwt do Bowtie 1 e eles não são compatíveis entre si.

bowtie2-inspect extrai informações de um índice Bowtie 2 sobre que tipo de índice ele é e quais sequências de referência foram usadas para criá-lo. Quando executada sem nenhuma opção, a ferramenta produzirá um arquivo FASTA contendo as sequências das referências originais (com todos os caracteres não A / C / G / T convertidos em Ns). Também pode ser usado para extrair apenas os nomes de sequência de referência usando a opção -n / - names ou um resumo mais detalhado usando a opção -s / - summary.


Agora vamos alinhar nossas leituras usando gravata borboleta

(Observação: para simplificar, colocaremos todos os arquivos relacionados ao bowtie no mesmo diretório. Para seu próprio trabalho, convém organizar sua estrutura de arquivos melhor do que a que temos).

Vamos pegar a gravata borboleta do Sourceforge:

descompacte o arquivo e crie um diretório para o bowtie. Neste caso, o programa é pré-compilado para que venha como um executável binário:

Copie os arquivos bowtie para um diretório em seu caminho de pesquisa shell e, em seguida, volte para o diretório pai (/ data / drosophila):

Vamos criar um novo diretório, “drosophila_bowtie” onde colocaremos todos os resultados da gravata borboleta:

Agora vamos construir um índice do genoma da Drosophila usando a gravata borboleta, assim como fizemos com o bwa. O genoma de referência da Drosophila original está no mesmo local que usamos antes. Novamente, já realizamos a etapa de indexação (leva cerca de 7 minutos), então se você quiser tentar você mesmo, indexe uma cópia para não sobrescrever aquela que executamos previamente para você:

Agora vamos mapear! No momento, usaremos as opções padrão da gravata borboleta. Vamos passar por isso. há alguns sinalizadores que definimos, uma vez que emparelhamos as leituras finais para essas amostras e vários processadores. O formato geral da gravata borboleta é (não execute isso):

No entanto, temos mais alguns detalhes que queremos incluir, portanto, há alguns sinalizadores que precisamos definir. -S significa que queremos a saída no formato SAM. -p 2 é para multithreading (usando mais de um processador). Neste caso, temos dois para usar. -1 -2 informa ao bowtie que essas são leituras finais emparelhadas (o .fastq) e especifica qual é qual.

Isso deve levar de 35 a 40 minutos para ser executado no conjunto de dados completo, então vamos executá-lo em uma versão aparada (deve levar cerca de 3 minutos depois, forneceremos resultados pré-calculados para o conjunto completo):

Você pode ver mensagens de aviso como:

Falaremos sobre algumas opções que você pode definir para lidar com isso.

Alguns argumentos / opções úteis adicionais (pelo menos para mim) -m # Suprime todos os alinhamentos para uma leitura particular se houver mais de m alinhamentos reportáveis. -v # não mais do que v incompatibilidades em todo o comprimento da leitura -n -l # número máximo de incompatibilidades na “semente” de alta qualidade, que são os primeiros l pares de base de uma leitura. -chunkmbs # número de MB de memória que uma thread é fornecida para armazenar o caminho. Útil quando você recebe avisos como acima –best # faz o Bowtie “garantir” que os alinhamentos singleton relatados são os “melhores” dadas as opções –tryhard # try hard para encontrar alinhamentos válidos, quando eles saem. MUITO DEVAGAR.


Justificativa

As melhorias na eficiência do sequenciamento de DNA ampliaram as aplicações de sequenciamento e aumentaram drasticamente o tamanho dos conjuntos de dados de sequenciamento. As tecnologias da Illumina (San Diego, CA, EUA) e da Applied Biosystems (Foster City, CA, EUA) foram usadas para criar perfis de padrões de metilação (MeDIP-Seq) [1], para mapear as interações DNA-proteína (ChIP-Seq) [ 2], e para identificar genes diferencialmente expressos (RNA-Seq) [3] no genoma humano e outras espécies. O instrumento Illumina foi recentemente usado para sequenciar novamente três genomas humanos, um de um paciente com câncer e dois de grupos étnicos anteriormente não sequenciados [4-6]. Cada um desses estudos exigia o alinhamento de um grande número de sequências curtas de DNA ('leituras curtas') no genoma humano. Por exemplo, dois dos estudos [4, 5] usaram a ferramenta de alinhamento de leitura curta Maq [7] para alinhar mais de 130 bilhões de bases (cerca de cobertura de 45 ×) de leituras Illumina curtas para um genoma de referência humano, a fim de detectar variações genéticas . O terceiro estudo de re-sequenciamento humano [6] usou o programa SOAP [8] para alinhar mais de 100 bilhões de bases ao genoma de referência. Além desses projetos, o projeto 1,000 Genomes está em processo de usar instrumentos de sequenciamento de alto rendimento para sequenciar um total de cerca de seis trilhões de pares de bases de DNA humano [9].

Com os métodos existentes, o custo computacional de alinhar muitas leituras curtas com o genoma de um mamífero é muito grande. Por exemplo, extrapolando os resultados apresentados aqui nas Tabelas 1 e 2, pode-se ver que Maq exigiria mais de 5 unidades de processamento central (CPU)-meses e SOAP mais de 3 CPU-anos para alinhar os 140 bilhões de bases do estudo por Ley e colegas de trabalho [5]. Embora o uso de Maq ou SOAP para essa finalidade tenha se mostrado viável com o uso de várias CPUs, há uma necessidade clara de novas ferramentas que consumam menos tempo e recursos computacionais.

Maq e SOAP usam a mesma abordagem algorítmica básica de outras ferramentas de mapeamento de leitura recente, como RMAP [10], ZOOM [11] e SHRiMP [12]. Cada ferramenta cria uma tabela hash de oligômeros curtos presentes nas leituras (SHRiMP, Maq, RMAP e ZOOM) ou na referência (SOAP). Alguns empregam avanços teóricos recentes para alinhar leituras rapidamente sem sacrificar a sensibilidade. Por exemplo, o ZOOM usa 'sementes espaçadas' para superar significativamente o desempenho do RMAP, que é baseado em um algoritmo mais simples desenvolvido por Baeza-Yaetes e Perleberg [13]. Sementes espaçadas demonstraram produzir maior sensibilidade do que sementes contíguas do mesmo comprimento [14, 15]. O SHRiMP emprega uma combinação de sementes espaçadas e o algoritmo Smith-Waterman [16] para alinhar leituras com alta sensibilidade em detrimento da velocidade. Eland é um programa de alinhamento comercial disponível na Illumina que usa um algoritmo baseado em hash para alinhar as leituras.

Bowtie usa uma estratégia de indexação diferente e inovadora para criar um alinhador de leitura curta ultrarrápido e com eficiência de memória voltado para o re-sequenciamento de mamíferos. Em nossos experimentos usando leituras do projeto 1,000 Genomes, Bowtie alinha leituras de 35 pares de bases (bp) a uma taxa de mais de 25 milhões de leituras por hora de CPU, que é mais de 35 vezes mais rápido que Maq e 300 vezes mais rápido que SOAP sob as mesmas condições (ver Tabelas 1 e 2). Bowtie emprega um índice de Burrows-Wheeler baseado no índice de espaço minuto de texto completo (FM), que tem uma pegada de memória de apenas cerca de 1,3 gigabytes (GB) para o genoma humano. O tamanho reduzido permite que o Bowtie seja executado em um computador desktop típico com 2 GB de RAM. O índice é pequeno o suficiente para ser distribuído pela Internet e armazenado em disco e reutilizado. Vários núcleos de processador podem ser usados ​​simultaneamente para atingir uma velocidade de alinhamento ainda maior. Usamos o Bowtie para alinhar a cobertura de 14,3 × das leituras Illumina humanas do projeto 1,000 Genomes em cerca de 14 horas em um único computador desktop com quatro núcleos de processador.

Bowtie faz várias concessões para atingir essa velocidade, mas essas compensações são razoáveis ​​no contexto de projetos de re-sequenciamento de mamíferos. Se uma ou mais correspondências exatas existirem para uma leitura, então Bowtie tem garantia de relatar uma, mas se a melhor correspondência for inexata, então Bowtie não tem garantia de encontrar o alinhamento de mais alta qualidade em todos os casos. Com suas configurações de desempenho mais altas, o Bowtie pode falhar ao alinhar um pequeno número de leituras com alinhamentos válidos, se essas leituras tiverem várias incompatibilidades. Se as garantias mais fortes forem desejadas, o Bowtie oferece suporte a opções que aumentam a precisão às custas de algum desempenho. Por exemplo, a opção '--best' garantirá que todos os alinhamentos relatados sejam os melhores em termos de minimização de incompatibilidades na porção inicial da leitura, embora esta opção incorra em custos computacionais adicionais.

Com suas opções padrão, a sensibilidade de Bowtie medida em termos de leituras alinhadas é igual a SOAP e um pouco menor que a de Maq. As opções de linha de comando permitem que o usuário aumente a sensibilidade ao custo de um maior tempo de execução e permite que o Bowtie relate vários acertos para uma leitura. Bowtie pode alinhar leituras de até quatro bases e até 1.024 bases. A entrada para uma única execução do Bowtie pode compreender uma mistura de leituras com comprimentos diferentes.


O programa FASTP original foi projetado para pesquisa de similaridade de sequência de proteínas. Por causa da expansão exponencial da informação genética e da velocidade e memória limitadas dos computadores na década de 1980, métodos heurísticos foram introduzidos, alinhando uma sequência de consulta a bancos de dados inteiros. FASTA, publicado em 1987, acrescentou a capacidade de fazer pesquisas de DNA: DNA, proteínas traduzidas: pesquisas de DNA e também forneceu um programa de embaralhamento mais sofisticado para avaliar a significância estatística. [2] Existem vários programas neste pacote que permitem o alinhamento de sequências de proteínas e sequências de DNA. Hoje em dia, o aumento do desempenho do computador torna possível realizar pesquisas para detecção de alinhamento local em um banco de dados usando o algoritmo Smith-Waterman.

FASTA é pronunciado como "fast A" e significa "FAST-All", porque funciona com qualquer alfabeto, uma extensão das ferramentas de alinhamento originais "FAST-P" (proteína) e "FAST-N" (nucleotídeo).

O pacote FASTA atual contém programas para proteínas: proteína, DNA: DNA, proteína: DNA traduzido (com frameshifts) e pesquisas ordenadas ou não ordenadas de peptídeos. Versões recentes do pacote FASTA incluem algoritmos de pesquisa traduzidos especiais que lidam corretamente com erros de frameshift (que pesquisas traduzidas de seis frames não lidam muito bem) ao comparar nucleotídeos com dados de sequência de proteínas.

Além dos métodos de pesquisa heurística rápida, o pacote FASTA fornece SSEARCH, uma implementação do algoritmo Smith – Waterman ideal.

Um foco principal do pacote é o cálculo de estatísticas de similaridade precisas, de modo que os biólogos possam julgar se um alinhamento provavelmente ocorreu por acaso ou se ele pode ser usado para inferir homologia. O pacote FASTA está disponível na University of Virginia [3] e no European Bioinformatics Institute. [4]

O formato de arquivo FASTA usado como entrada para este software agora é amplamente usado por outras ferramentas de pesquisa de banco de dados de sequência (como BLAST) e programas de alinhamento de sequência (Clustal, T-Coffee, etc.).

FASTA pega um determinado nucleotídeo ou sequência de aminoácidos e pesquisa um banco de dados de sequência correspondente usando o alinhamento de sequência local para encontrar correspondências de sequências de banco de dados semelhantes.

O programa FASTA segue um método amplamente heurístico que contribui para a alta velocidade de sua execução. Ele inicialmente observa o padrão de acertos de palavra, correspondências palavra a palavra de um determinado comprimento e marca correspondências potenciais antes de realizar uma pesquisa otimizada mais demorada usando um tipo de algoritmo Smith-Waterman.

O tamanho de uma palavra, dado pelo parâmetro kmer, controla a sensibilidade e a velocidade do programa. Aumentar o valor de k-mer diminui o número de ocorrências de fundo que são encontradas. A partir das ocorrências de palavras que são retornadas, o programa procura segmentos que contenham um grupo de ocorrências próximas. Em seguida, investiga esses segmentos para uma possível correspondência.

Existem algumas diferenças entre fastn e fastp relacionadas ao tipo de sequência usada, mas ambos usam quatro etapas e calculam três pontuações para descrever e formatar os resultados de similaridade de sequência. Estes são:

  • Identifique as regiões de maior densidade em cada comparação de sequência. Tomando um k-mer igual a 1 ou 2.
  • Pesquise novamente as regiões obtidas usando as matrizes de pontuação. aparar as pontas da região para incluir apenas aqueles que contribuem para a pontuação mais alta.
  • Em um alinhamento, se várias regiões iniciais com pontuações maiores do que um valor CUTOFF forem encontradas, verifique se as regiões iniciais aparadas podem ser unidas para formar um alinhamento aproximado com lacunas. Calcule uma pontuação de similaridade que é a soma das regiões unidas penalizando para cada lacuna 20 pontos. Esta pontuação de semelhança inicial (initn) é usado para classificar as sequências da biblioteca. A pontuação da melhor região inicial única encontrada na etapa 2 é relatada (init1).
  • Use um algoritmo Smith – Waterman com faixas para calcular uma pontuação ideal para o alinhamento.

O FASTA não pode remover regiões de baixa complexidade antes de alinhar as sequências, pois é possível com o BLAST. Isso pode ser problemático quando a sequência de consulta contém tais regiões, por exemplo, mini- ou microssatélites repetindo a mesma sequência curta vezes frequentes, isso aumenta a pontuação de sequências não familiares no banco de dados que só combinam nessas repetições, que ocorrem com bastante frequência. Portanto, o programa PRSS é adicionado ao pacote de distribuição FASTA. O PRSS embaralha as sequências correspondentes no banco de dados no nível de uma letra ou embaralha segmentos curtos cujo comprimento o usuário pode determinar. As sequências embaralhadas agora estão alinhadas novamente e se a pontuação ainda for maior do que o esperado, isso é causado pelas regiões de baixa complexidade sendo misturadas ainda mapeando para a consulta. Pelo valor da pontuação, as sequências embaralhadas ainda atingem PRSS, agora podemos prever a significância da pontuação das sequências originais. Quanto maior a pontuação das sequências embaralhadas, menos significativas serão as correspondências encontradas entre o banco de dados original e a sequência de consulta. [5]

Os programas FASTA encontram regiões de similaridade local ou global entre sequências de proteínas ou DNA, seja pesquisando bancos de dados de proteínas ou DNA, ou identificando duplicações locais dentro de uma sequência. Outros programas fornecem informações sobre a significância estatística de um alinhamento. Como o BLAST, o FASTA pode ser usado para inferir relações funcionais e evolutivas entre sequências, bem como ajudar a identificar membros de famílias de genes.


Bowtie: não é possível ler o arquivo fasta? - Biologia

As etapas analíticas são predefinidas e fornecidas pelos gerentes de pipeline. Envie um e-mail para [email protected] se tiver alguma dúvida.

1. Mapeamento do genoma de referência

1-1. Etapas analíticas das respectivas ferramentas analíticas

(1) Maq
O Maq realiza análises a cada 200M de leituras. Assim, dividimos um arquivo de consulta em vários arquivos.

No caso de análise de extremidade única:

Split 200M lê com janela de visualização de detalhes.
leia: RUN Accession_0000
RUN Accession_0001


Passos
Ferramenta
Explicação
maq fasta2bfa in.ref.fasta out.ref.bfa Maq Prepare-se para fazer o 'alinhamento'.
Converta o formato de arquivo da referência FASTA para bfa.
maq fastq2bfq (fasta2bfa) in.read1.fastq (.fasta) out.read1.bfq (.bfa) Maq Prepare-se para fazer o 'alinhamento'.
Converta o formato de arquivo das leituras FASTA para bfq.
mapa maq [opção] out_0.map in.ref.bfa in.read1.bfq (.bfa) Maq Alinhe as leituras com as sequências de referência.
maq mapmerge out_all.map out_0.map out_1.map .... Maq Marque o resultado para dividir e alinhar o arquivo de consulta.
maq mapview out_all.map mapview.txt Maq Converta o formato do arquivo do resultado binário em texto.
O resultado do alinhamento foi incluído em 'mapview.txt'.
maq mapcheck in.ref.bfa out_all.map & gt mapcheck.txt Maq Verifique as qualidades das leituras.
O resultado foi incluído em 'mapcheck.txt'.
maq indelsoa in.ref.bfa out_all.map & gt out.indel.soa Maq Detecção de indels e break points.
O resultado foi incluído no arquivo 'out.indel.soa'.
maq assemble [opção] out.cns in.ref.bfa out_all.map Maq Geração das sequências de consenso dos alinhamentos.
O resultado foi incluído no arquivo 'out.cns'.
maq cns2snp out.cns & gt out.snp Maq Detecção de SNPs.
O resultado foi incluído no arquivo 'out.snp'.
maq.pl SNPfilter [opção] out.snp & gt out.filter.snp Maq Filtro SNP.
maq2sam out_all.map & gt out.sam SAMtools
Converta o formato do alinhamento Maq para SAM.
O resultado formatado do SAM no SAM foi incluído em 'out.sam'.

No caso de análise de extremidade pareada:

Dividir 200M lê cada um, o que foi processado apareceu na 'Visualização de detalhes' do pipeline, como abaixo.

read1: RUN Accession_1_0000
RUN Accession_1_0001

read2: RUN Accession_2_0000
RUN Accession_2_0001

ex.) read1: DRR000001_1_0000
read2: DRR000001_2_0000


Assista o vídeo: Gerenciando Riscos com o Método Bowtie (Fevereiro 2023).