Em formação

Necessidade de dois sensores de oxigênio em E. coli

Necessidade de dois sensores de oxigênio em E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

E. coli tem dois sensores de oxigênio: FNR (fumarato-nitrato redutase) e ArcBA (Anoxic Redox Control, dois sistemas de controle de componentes). O FNR detecta diretamente o oxigênio, enquanto a interação do ArcB com o oxigênio é indireta através do pool de quinonas. De lá, quionones em E. coli, qual (formas oxidadas e reduzidas de todos os três tipos) desempenham papéis em que medida em que direção (inibição / ativação) é muito discutível. Eu gostaria de ver alguns argumentos de nível intuitivo para explicar por que uma célula, mesmo em princípio, precisa ter dois sensores de oxigênio?


Não é incomum que as células tenham vias paralelas para o mesmo resultado. Isso garante uma resposta infalível e torna o sistema robusto. E.coli também possui outro sensor para aerotaxia (proteínas Aer e Tsr). Veja minha resposta em seu post anterior e no link do artigo.

Procure também motivos de rede de alimentação direta coerentes.


Detecção de oxigênio e redox por sistemas de dois componentes que regulam as respostas comportamentais: ensaios comportamentais e estudos estruturais de aer usando reticulação de dissulfeto in vivo

Um aumento notável no número de sensores anotados de aerotaxia (busca de oxigênio) e táxis redox pode ser atribuído aos avanços recentes na genômica bacteriana. No entanto, as previsões in silico devem ser apoiadas por ensaios comportamentais e análises genéticas que confirmem uma função de aerotaxia ou redox taxis. Este capítulo apresenta uma coleção de procedimentos que tiveram grande sucesso na caracterização de aerotaxia e táxis redox em Escherichia coli. Os métodos são descritos em detalhes suficientes para permitir que pesquisadores de outras espécies adaptem os procedimentos para seu uso. Uma célula de fluxo de gás é usada para quantificar as respostas temporais das bactérias a um aumento ou diminuição da pressão parcial de oxigênio ou potencial redox. O comportamento bacteriano em gradientes espaciais é analisado usando capilares opticamente planos e placas de ágar mole (ágar succinato ou ágar triptona). Descrevemos duas abordagens para estimar a pressão parcial preferencial de oxigênio que atrai uma espécie bacteriana, esta concentração é importante para a compreensão da ecologia microbiana. No nível molecular, descrevemos os procedimentos usados ​​para determinar a estrutura e topologia do Aer, um receptor de membrana para aerotaxia. Mutagênese de varredura de cisteína e procedimentos de reticulação de dissulfeto in vivo utilizam o oxidante Cu (II) - (1,10-fenantrolina) (3) e sondas bifuncionais reativas ao sulfidrila. Finalmente, descrevemos os métodos usados ​​para determinar os limites dos segmentos transmembrana de receptores, como Aer. Estes incluem 5-iodoacetamidofluoresceína, ácido 4-acetamido-4-dissulfônico, sal dissódico (AMS) e metoxi polietilenoglicol maleimida, uma sonda de massa molecular de 5 kDa que altera a mobilidade de Aer em SDS-PAGE.


Fundo

Detecção não invasiva de O intracelular2 é de particular importância, pois é um dos principais metabólitos dos organismos aeróbicos obrigatórios e facultativos. Cellular O2 é um indicador proeminente de atividades metabólicas dependentes de oxigênio, como respiração aeróbica ou síntese dependente de oxigênio e degradação de componentes celulares [1, 2]. Além disso, vários processos biológicos, patológicos e biotecnológicos são controlados por O2 limitação, incluindo a formação de biofilme e interações patógeno-hospedeiro [3-7], processos inflamatórios induzidos por hipóxia [8], fisiopatologia do tumor [9-12], bem como processos de fermentação microbiana usados ​​para biorremediação e produção de alimentos, rações e biocombustíveis [ 13–16].

Até o momento, diferentes fluorescência minimamente invasiva e fosforescência com base em O2Sondas sensíveis foram desenvolvidas para imagens de oxigênio molecular em células e tecidos. Entre eles, os corantes platina (II) -porfirina são amplamente usados ​​para analisar as respostas induzidas por hipóxia de células de mamíferos [17-19]. Alternativamente, a proteína fluorescente verde (GFP) e suas variantes podem ser aplicadas como sondas intracelulares geneticamente codificadas que são expressas especificamente e podem ser direcionadas seletivamente dentro de células e tecidos definidos. Neste contexto, pelo menos dois sensores de oxigênio baseados em GFP 'passivos' foram desenvolvidos para estimar os níveis de oxigênio intracelular em E. coli. Aqui, a GFP foi aplicada como uma proteína repórter expressa sob controle de E. coli promotores [20, 21]. Além disso, a fotoativação sensível ao oxigênio da fluorescência vermelha mediada por GFP foi aplicada para na Vivo imagiologia de oxigênio em células e órgãos de mamíferos [22-24].

Notavelmente, o oxigênio molecular atualmente não pode ser analisado na Vivo por biossensores baseados em FRET geneticamente codificados, embora esses biossensores constituam uma das classes mais difundidas de sondas moleculares fluorescentes usadas para a análise quantitativa não invasiva de compostos intracelulares, incluindo Ca 2+, Zn 2+, Cl -, pH, H2O2, ATP, maltose, sacarose, ribose e glicose [25-27]. No que diz respeito à detecção de oxigênio, no entanto, proteínas semelhantes a GFP, que são comumente usadas como domínios doadores e aceitadores de biossensores FRET, apresentam uma grande desvantagem: sua síntese cromóforo autocatalítica depende estritamente da presença de oxigênio molecular [28, 29] e, portanto, a intensidade do sinal de fluorescência basicamente não reflete a quantidade de proteína repórter sintetizada [30]. Portanto, GFP e suas variantes de cor não podem ser usados ​​apenas como domínios de biossensores fluorescentes para O2 determinação.

Recentemente, desenvolvemos uma nova classe de proteínas fluorescentes que carregam o mononucleotídeo de flavina (FMN) como cromóforo [31]. Em contraste com FPs semelhantes a GFP, o sinal de fluorescência dessas proteínas fluorescentes baseadas em FMN (FbFP) é independente do oxigênio celular e, portanto, FbFP pode ser usado como quantitativo na Vivo proteína repórter em tempo real sob condições aeróbicas, bem como anaeróbias [30, 31]. Aqui, relatamos a construção e aplicação do primeiro biossensor baseado em FRET geneticamente codificado para oxigênio denominado FluBO, que consiste no domínio doador FbFP insensível ao oxigênio e no domínio aceitador da proteína fluorescente amarela aprimorada sensível à hipóxia (YFP). Mostramos ainda que sua eficiência FRET responde dinamicamente à mudança de O2 valores em células bacterianas vivas.


Introdução

Rhizobia são alfa-proteobactérias que se envolvem em simbiose com plantas leguminosas [1]. As bactérias convertem o N atmosférico inerte2 em amônia biologicamente acessível e fornecê-la ao hospedeiro da planta em um processo denominado fixação de nitrogênio [2,3]. Toda a fixação biológica é catalisada pelo complexo da enzima nitrogenase que evoluiu antes do Grande Evento de Oxigenação e requer condições quase anóxicas para funcionar [4-6]. No entanto, os rizóbios são aeróbios obrigatórios e devem respirar para atender às altas demandas de energia da fixação de nitrogênio [7,8]. Esses requisitos concorrentes criam um "paradoxo do oxigênio" na fixação simbiótica de nitrogênio [9,10]. Para superar este paradoxo, a intrincada cooperação entre os rizóbios e suas plantas parceiras evoluiu (revisado em [11,12]). As leguminosas hospedam rizóbios em nódulos de raiz dedicados que se formam onde as bactérias entraram na raiz da planta, geralmente por meio de fios de infecção (revisado em [13,14]). Os nódulos criam um ambiente interno quase anóxico adequado para a atividade da nitrogenase [15-17]. Para produzir este ambiente, oxigênio (O2) é capturado e transportado para bacteroides pelas leghemoglobinas vegetais [18-21]. A concentração de O livre restante2 no núcleo, a zona de fixação de nitrogênio dos nódulos é tão baixa quanto 20–50 nM [22,23]. Os rizóbios passam por uma mudança radical no estilo de vida após a entrada do nódulo para sobreviver e fixar o nitrogênio nessas condições (revisado em [24,25]). Em nódulos indeterminados, como os produzidos por Pisum sativum (ervilha), os rizóbios são inicialmente de vida livre na entrada [26,27]. Eles, então, passam por mudanças irreversíveis no estilo de vida à medida que se movem da ponta do nódulo até seu núcleo [28,29]. Começando na zona II e acelerando na interzona II-III, os rizóbios se diferenciam terminalmente em bacteróides quase organelos especializados para a fixação de nitrogênio [30,31]. A zona III de nódulos indeterminados contém bacteróides diferenciados que fixam ativamente o nitrogênio [32]. Mecanismos reguladores rizobianos sensíveis a O2 tensão são essenciais para a diferenciação bem-sucedida em bacteróides e o estabelecimento de uma simbiose produtiva [33-35].

Múltiplo O2 sensores evoluíram em rizóbios, três dos quais são comuns e freqüentemente coexistem dentro do mesmo organismo [11,36]. A primeira é a proteína FixL ligada à membrana, que forma um sistema de dois componentes (TCS) com a proteína receptora FixJ (revisada em [37,38]). Em condições microaeróbicas, FixL fosforila FixJ, que por sua vez induz a expressão do fixK fator de transcrição [39-41]. FixK induz a expressão de genes a jusante ligando-se como um dímero a um motivo ‘anaerobox’ (TTGAT-N4-ATCAA) a montante de seus promotores [42,43].

O segundo O comum2 sensor é uma variante do FixL chamado Hybrid FixL (hFixL) [44,45]. Isso forma um TCS alternativo com FxkR atuando como a proteína receptora. FxkR não é um homólogo de FixJ, mas de forma semelhante induz a expressão de fixK, ligando-se a um motivo "K-box" a montante (GTTACA-N4-GTTACA) [46]. O terceiro O2 sensor é o fator de transcrição FnrN. Como FixK, FnrN se liga ao motivo anaerobox como um dímero e ambos são homólogos próximos do E. coli regulador de anaerobiose FNR [47-49]. Ao contrário de FixK, mas como FNR, FnrN contém um cluster rico em cisteína N-terminal que torna a proteína um sensor direto de O2 [50–53]. Os sensores FixL e hFixL são conhecidos por se tornarem ativos em condições microaeróbicas relativamente suaves, incluindo em rizóbios de vida livre [54-56]. É provável que FnrN seja muito menos O2 tolerante. O O2 a sensibilidade de FnrN não foi determinada, mas o E. coli O homólogo de FNR é ativo apenas em condições anaeróbicas [57-59]. Todos os rizóbios simbióticos estudados até o momento empregam pelo menos um desses três sensores [11]. É comum que esses sensores coexistam, principalmente em Rhizobium leguminosarum biovar viciae VF39, várias cepas de Ensifer meliloti (anteriormente Sinorhizobium meliloti) e Rhizobium etli CFN42 [44,45,60–62].

Enfatizando ainda mais a importância de O2 regulação na fixação simbiótica de nitrogênio, rizóbios também empregam o O2 detecção do fator de transcrição NifA para regular sua diferenciação final em bacteróides fixadores de nitrogênio (para revisões, ver [38,63]). Acredita-se que a sensibilidade ao oxigênio do NifA derive de um motivo rico em cisteína de ligação de metal em um ligante interdomínio da proteína [64-66]. A proteína tem um grande regulon, notavelmente incluindo componentes de nitrogenase, como nifH [67–70]. Expressão de nifA é tipicamente autorregulado em rizóbios, muitas vezes por meio de leitura de um gene ou operon upstream que é regulado por NifA, em muitos casos fixABCX [69,71-73]. Em Rlv3841, um fixABCX operon é encontrado diretamente a montante de nifA, sugerindo tal mecanismo de auto-ativação NifA de leitura. Normalmente, nenhuma expressão de nifA nem a atividade da proteína é diretamente regulada pelos três O2 sensores descritos acima [11]. Uma exceção notável é E. meliloti, Onde nifA é regulado pelo sistema FixLJ [74-76]. Não há evidências de que FixK ou FnrN regulem diretamente nifA expressão em Rlv3841.

Parece haver um espectro entre os rizóbios, com algumas espécies segregando os sensores de oxigênio em vias separadas, enquanto em outras espécies esses sensores se fundiram parcial ou completamente em uma via hierárquica combinada [77,78]. Onde os sensores de oxigênio estão em caminhos separados, freqüentemente existe redundância. Nessas situações, a perda de um sensor de oxigênio não abole a atividade de fixação de nitrogênio [79,80]. Em contraste, onde os sensores foram fundidos em uma única via regulatória, alguns componentes são individualmente essenciais [11]. Assim, a perda de um sensor de oxigênio pode prejudicar gravemente a fixação de nitrogênio, mesmo se outros sensores permanecerem.

No R. leguminosarum bv. VF39, eliminando FnrN ou hFixL reduziu a fixação de nitrogênio para 30% ou 50% do WT, respectivamente, sugerindo um arranjo redundante não hierárquico [60]. A via hFixL-FxkR-FixK de R. etli CFN42 é dispensável como um duplo fixK mutante não teve efeito na fixação de nitrogênio, enquanto um duplo fnrN mutante reduziu a fixação para 20% dos níveis de WT. Por contraste, R. etli CFN42 parece empregar uma via hierárquica complexa, com vários homólogos de FixK e FnrN regulando a expressão um do outro [61,62]. Espécies que codificam homólogos de apenas hFixL ou FnrN também foram encontradas. Rhizobium leguminosarum biovar viciae UPM791 contém dois homólogos FnrN, mas nem FixL nem hFixL [81]. Não se sabe se as duas proteínas FnrN respondem a diferentes O2 concentrações ou agir de maneira redundante. E. meliloti 1021 não contém homólogo FnrN, mas um sistema FixLJ bem estudado e parece ter homólogos de hFixL e FxkR [82-84].

Para examinar a relação entre hFixL e FnrN, estudamos o organismo modelo Rhizobium leguminosarum biovar viciae 3841 (Rlv3841) que emprega ambos os sensores (Fig 1) [85,86]. Rlv3841 tem um único cromossomo cujos nomes de genes começam com RL e seis megaplasmídeos pRL7-12 cujos nomes de genes começam com, e. pRL9. O principal plasmídeo simbiótico é o pRL10, mas muitos genes simbióticos também são encontrados em pRL9, incluindo uma cópia do fixNOQP e fixGHIS operon. Rlv3841 codifica duas cópias de hfixL, que chamamos de hfixL9 (pRL90020 em pRL9) e hfixLc (RL1879 no cromossomo), com 54,9% de identidade em nível de proteína. A cepa também contém dois homólogos (58% de identidade) de fxkR, fxkR9 (pRL90026) e fxkRc (RL1881). Tem três putativos fixK genes, que designamos fixK9a (pRL90019), fixK9b (pRL90025) e fixKc (RL1880). o fixK9a e fixK9b sequências têm 53% de identidade de aminoácidos, enquanto fixKc compartilha 38% e 47% de identidade com essas proteínas, respectivamente. Ambos fixK9a-hfixL9 e fixKc-hfixLc parecem formar operons (Fig. 1B e 1D). Rlv3841 tem uma cópia do fnrN (RL2818), regulado por duas anaeroboxes. Um arranjo anaerobox dual semelhante existe em Rlv UPM791, onde FnrN auto-regula positiva e negativamente sua própria expressão [87]. A ligação de FnrN ao anaerobox distal induz fnrN a transcrição e a ligação ao anaerobox proximal o reprime. A ativação automática de FnrN também foi relatada em Rhizobium etli CNPAF512 [88]. Regulamento FixK de fnrN expressão é provável, pois também se liga a anaeroboxes, mas isso não foi investigado.

O oxigênio é mostrado em diamantes vermelhos. As proteínas são mostradas como ovais, os locais dos operadores como quadrados e os genes como retângulos pontiagudos. Os sites de início da transcrição são mostrados como setas em ângulo reto. As terminações de linha indicam ativação (setas), inibição (extremidade cega) e translação (círculo). (UMA) A via única formada pelos dois sensores atua em dois estágios. O estágio I começa em condições microaeróbicas e pode funcionar fora do nódulo. Neste estágio, hFixL está ativo, mas FnrN não. hFixL ativa FxkR, que se liga ao operador K-box (quadrados laranja “K”) para induzir a expressão de fixK. FixK se liga a operadores anaerobox (quadrados "A" azuis) para induzir a expressão, incluindo a montante de fixNOQP (linha tracejada) e fnrN. Uma vez que o oxigênio na bactéria atinge níveis quase anaeróbicos, o FnrN torna-se ativo e o estágio II começa. Como FixK, FnrN liga anaeroboxes. Auto-regula fnrN positiva e negativamente e induz fixNOQP expressão. (B) Rlv3841 tem várias cópias de vários genes de regulação do oxigênio e muitos estão organizados em clusters. No megaplasmídeo pRL9, fixK9a forma um operon com hfixL9, regulado por uma K-box. Este operon é adjacente a fixNOQP9, regulado por um anaerobox. (C) fixK9b e fxkR9 são adjacentes, com um anaerobox e uma K-box em sua região intergênica. (D) O cromossomo Rlv3841 também tem um cluster, contendo fxkRc, fixKc e hfixLc. Ao contrário dos clusters semelhantes em pRL9, a região intergênica deste cluster não contém operadores anaerobox ou K-box. (E) O fnrN gene não faz parte de um cluster e é regulado positiva e negativamente por uma anaerobox distal e proximal, respectivamente. Detalhes do local de início da transcrição, anaerobox e locais K-box podem ser encontrados na Tabela 1.

Um estudo em R. leguminosarum VF39 descobriu que a expressão microaeróbica de fnrN também requer RpoN [89]. Esta descoberta não foi replicada em outro lugar, e seu significado permanece obscuro. Trabalhar em R. etli CNPAF512 mostrou que fnrN não é controlado pelo RpoN naquele organismo [88]. Rlv3841 codifica um putativo rpoN gene (RL0422), mas não encontramos sítios de ligação RpoN a montante do Rlv3841 fnrN site de início da transcrição. RpoN, portanto, não parece ser necessário para fnrN expressão em Rlv3841.

Um arranjo paralelo de hFixL-FxkR-FixK e FnrN em Rlv3841 produziria redundância, enquanto um arranjo em série criaria hierarquia entre os dois reguladores. Nosso objetivo é, portanto, entender como os dois sensores interagem no Rlv3841 e fornecer uma visão sobre por que eles coexistem.


Resumo

A deterioração microbiana e as doenças de origem alimentar causam perdas econômicas e de produtividade significativas. Há uma necessidade de novas abordagens e tratamentos antimicrobianos para estender a vida útil dos produtos, melhorar a qualidade e a segurança microbiana e reduzir a deterioração e o desperdício, e novos métodos de avaliação. Os ensaios tradicionais para testar a toxicidade de antimicrobianos são demorados, trabalhosos, fornecem estimativas grosseiras de toxicidade e não podem analisar amostras complexas, como homogenatos de alimentos crus. Usando um composto antimicrobiano modelo Lauroyl Arginate Ethyl Ester (LAE), descrevemos uma nova metodologia analítica baseada em detecção óptica de oxigênio e respirometria para investigar os efeitos de vários tratamentos antimicrobianos em culturas bacterianas puras, microbiota de carne e amostras de carne embalada. Medindo e analisando os perfis de tempo de O2 sonda (tempo de vida da fosforescência) na incubação de amostras de teste, pudemos visualizar os efeitos tóxicos do LAE nas diferentes espécies bacterianas, gerar curvas de tempo e dose-resposta, calcular EC50 e tempos de geração de organismos de teste. A nova plataforma de testes multiparamétricos de toxicidade permite uma análise rápida, automatizada e paralela de várias amostras sob uma variedade de concentrações e condições antimicrobianas.


Projeto e engenharia de cepas de sensores metabólicos de E. coli com uma ampla faixa de sensibilidade para glicerato

Biossensores microbianos são usados ​​para detectar a presença de compostos fornecidos externamente ou produzidos internamente. O último caso é comumente restringido pela necessidade de rastrear uma grande biblioteca de variantes de enzimas ou vias para identificar aquelas que podem gerar eficientemente o composto desejado. Para resolver essa limitação, sugerimos o uso de cepas de sensores metabólicos que podem crescer apenas se o composto relevante estiver presente e, assim, substituir a triagem por seleção direta. Usamos uma plataforma computacional para projetar cepas de sensores metabólicos com dependências variadas de um composto específico. Nosso método explora sistematicamente combinações de deleções de genes e identifica como a necessidade de crescimento de um composto muda com a composição da mídia. Demonstramos essa abordagem construindo um conjunto de cepas sensoras de glicerato de E. coli. Em cada uma dessas cepas, um conjunto diferente de enzimas é interrompido de modo que o metabolismo central seja efetivamente dissecado em vários segmentos, cada um exigindo uma fonte de carbono dedicada. Encontramos uma correspondência quase perfeita entre a dependência prevista e experimental do glicerato e mostramos que as cepas podem ser usadas para detectar com precisão as concentrações de glicerato em duas ordens de magnitude. Além de demonstrar o potencial de aplicação de cepas de sensores metabólicos, nosso trabalho revela fenômenos-chave no metabolismo central, incluindo a degradação espontânea de metabólitos centrais e a importância de sumidouros metabólicos para equilibrar pequenas redes metabólicas.

Palavras-chave: Modelo metabólico baseado em restrição de auxotrofia Seleção de crescimento Biologia sintética.

Copyright © 2019 The Authors. Publicado pela Elsevier Inc. Todos os direitos reservados.


Engenharia do Reator

13.4.8 Controle Programado

Devido ao caráter inerente de variação no tempo das fermentações em lote e lote alimentado, manter um ambiente constante ou valores constantes de variáveis ​​metabólicas nem sempre é a estratégia de controle ideal. Dependendo do processo, mudanças em variáveis ​​como pH e temperatura em momentos críticos podem melhorar a taxa de produção e o rendimento. A variação da taxa de alimentação é importante nas fermentações de levedura de padeiro de lote alimentado para minimizar o efeito Crabtree e maximizar a produção de biomassa. A taxa de alimentação também é manipulada em E. coli fermentações para reduzir a síntese de subprodutos. Em fermentações de metabólitos secundários, a taxa de crescimento específica deve ser alta no início da cultura, mas, em altas densidades celulares, diferentes condições são necessárias para retardar o crescimento e estimular a formação do produto. Estratégias semelhantes são necessárias para otimizar a síntese de proteínas de organismos recombinantes. A expressão do produto recombinante é geralmente evitada no início da cultura porque o crescimento celular é adversamente afetado; no entanto, mais tarde no lote, um indutor é adicionado para ativar a síntese de proteínas.

Para muitos bioprocessos, uma sequência de tempo particular de pH, temperatura, tensão de oxigênio dissolvido, taxa de alimentação e outras variáveis ​​é necessária para desenvolver a cultura de forma que a produtividade seja maximizada. Uma estratégia de controle que pode acomodar mudanças abrangentes nas variáveis ​​de fermentação é controle programado, também conhecido como programação do fermentador em lote. No controle programado, a política de controle consiste em uma programação de funções de controle a serem implementadas em vários momentos durante o processo. Este tipo de controle requer uma compreensão detalhada dos requisitos do processo em vários estágios e um modelo matemático razoavelmente completo e preciso do sistema.


MATERIAIS E MÉTODOS

Materiais

Mycobacterium tuberculosis O DNA genômico de H37Rv foi obtido do Dr. Jeffery Cox da University of California, San Francisco. A ampicilina foi adquirida da Fisher Biotech enquanto o cloranfenicol foi obtido da Roche, hemina da Fluka Biochemica, ditionito da JT Baker e IPTG da Promega. A lisozima e o fluoreto de fenilmetilsulfonilo eram da Sigma. Inibidores de protease (antipaina, leupeptina e pepstatina), cloranfenicol, sistema Fast Start High Fidelity PCR e polimerase Amplitaq foram obtidos da Roche. Uma escada de DNA de 1 kbplus foi adquirida da Life technologies. Argon e CO eram da Matheson Tri-Gas.

Simply Blue Safe Stain, In Vision Histag In-Gel Stain, Veja marcadores de proteína Blue Plus 2, S.O.C. meio, juntamente com o aparelho de gel (Novex MiniCell), géis NuPage 12% Bis-Tris e tampão de corrida NuPage MOPS SDS foram adquiridos da Invitrogen. o E. coli As células XL-10 gold, BL21DE3 e XL-1 Blue eram da Stratagene.

O kit de clonagem TOPO TA foi obtido da Invitrogen e o kit QuikChange Mutagenesis da Stratagene. A purificação do DNA foi realizada usando kits QIAgen. As enzimas de restrição, T4 DNA ligase e fosfatase alcalina eram de New England Biolabs. As colunas HisTrap TM HP foram obtidas na GE Healthcare, enquanto os tubos de diálise foram adquiridos nos laboratórios Spectrum, Inc.

O plasmídeo pET23a + foi adquirido na Novagen. O plasmídeo pTGroE foi gentilmente cedido pelo Dr. Shunsuke Ishii do Laboratório de Genética Molecular, Riken Tsukuba Life Science Center, Japão.

Os primers foram projetados usando o pacote de software GCG versão 10.3 para UNIX da University of Wisconsin. Os primers personalizados foram sintetizados pela Invitrogen. As análises de aminoácidos foram realizadas na Universidade da Califórnia, Davis. As amostras de DNA foram sequenciadas na Universidade da Califórnia, Berkeley.

Clonando o gene DevS completo

O gene DevS foi amplificado a partir de Mycobacterium tuberculosis DNA genômico de H37Rv usando um PCR PTC-200 Peltier Thermal Cycler da MJ Research e o sistema Fast Start High Fidelity PCR da Roche. A 10 min. a desnaturação inicial a 94 & # x000b0C foi seguida por 35 ciclos: 94 & # x000b0C 1 min., 45 & # x000b0C 1,5 min, 72 & # x000b0C 3 min e uma extensão final de 10 min a 72 & # x000b0C. O primer direto (GGATAGGGCATATGACAACAGGGGGCCTC) incluiu um NdeLocal de clivagem I, enquanto o primer reverso (CCAAACGGGGATCCGAAGAGCTACTGCGACAAC) continha um BamH1 site. A mistura de reação continha 4% de DMSO. O produto obtido nesta reação foi reamplificado nas mesmas condições para se obter quantidades suficientes de produto de PCR.

Clonagem TOPO TA

3 & # x02019 Alianças de poli-adenina foram adicionadas ao produto de PCR purificado usando Amplitaq DNA polimerase. A reação de clonagem TOPO TA foi realizada por 30 min em temperatura ambiente, de acordo com as instruções do fabricante & # x02019s usando o vetor pCR2.1-TOPO. O DNA de plasmídeo foi purificado de várias colônias de células TOP10 transformadas com o produto da reação de clonagem TOPO TA. A inserção do gene DevS foi verificada usando digestões de restrição (ou Ncoeu ou NãoI) e a sequência correta do gene DevS foi confirmada por sequenciamento de DNA.

Subclonagem de DevS642

Os primeiros 642 pb que codificam para o domínio GAF N-terminal foram amplificados usando as mesmas condições de PCR e os seguintes primers: CCGCCGCCATATGCATCATCATCATCATCATCACGAGAACTTATATTTTTTCAAGGAATGACAACAGGGGGCCTCGTCGAC (forwarder contendo um marcador 6-His e um primer NdeLocal de clivagem I) e CGGACAAGCTTCTATTACGACTGACGCGCCTTAGCCTGCTG (o primer reverso que inclui um TraseiroLocal III). O produto de PCR purificado foi digerido com Ndeeu e TraseiroIII e ligado a pET23a + clivado com as mesmas enzimas de restrição, bem como com fosfatase alcalina. As células ultracompetentes XL-10 gold foram transformadas com o produto de ligação. Após análise de restrição, o DNA do plasmídeo também foi submetido a sequenciamento para confirmação da sequência correta.

Mutagênese de His149 de DevS642

O kit QuikChange Mutagenesis da Stratagene foi usado para transformar His149 em uma alanina de acordo com as instruções do fabricante & # x02019s. Os iniciadores mutagênicos usados ​​foram: CGATTGGTTTTCCGCCGTATGCCCCGCCGATGCGTACCTTCCT (iniciador direto) AGGAAGGTACGCATCGGCGGGGCATACGGCGGAAAACCAATCG (iniciador reverso). As construções foram submetidas a sequenciamento de DNA para confirmação da sequência correta.

Expressão de DevS642 e DevS completo

Células BL21gold DE3 foram cotransformadas com pET23a + DevS642 e pT-GroE. As células foram cultivadas em placas LB contendo ampicilina (50 & # x003bcg / mL) e cloranfenicol (34 & # x003bcg / mL). Cinco culturas iniciais foram então inoculadas com uma colônia cada. As cinco culturas foram então reunidas e usadas para inocular frascos contendo 1,5 L de meio LB, bem como os antibióticos ampicilina (100 & # x003bcg / mL) e cloranfenicol (34 & # x003bcg / mL). As células foram cultivadas até uma densidade óptica de OD600 0,8 a 37 & # x000b0C e 230 rpm. Hemin foi adicionado antes da indução (45 mg / 4,5 mL NaOH 0,1 N para cada 1,5 L de cultura). A expressão da proteína foi induzida com IPTG na concentração final de 1 mM e os frascos foram mantidos a 18 & # x000b0C por 20 h. As células foram colhidas por centrifugação a 5000 rpm durante 25 min. além do mais E. coli BL21DE3, duas outras linhas de células foram testadas: Rosetta 2 e DH5 & # x003b1. As células DH5 e # x003b1 não expressaram a proteína desejada quando foram transformadas apenas com o plasmídeo que codifica DevS642 ou quando foram cotransformadas para fornecer também o complexo GroEL / ES. As células Rosetta 2 também foram testadas, porque vários códons de menor uso em E. coli foram identificados dentro do gene. Verificou-se, no entanto, que o nível de expressão não foi significativamente aumentado. O DevS de comprimento total foi clonado em pET23a + usando a mesma estratégia que no caso da proteína DevS642 wt. O DevS de comprimento total foi co-expresso com o complexo GroEL / ES e, em seguida, purificado usando as mesmas condições.

Expressão de ApoDevS642

O mesmo procedimento foi seguido para a proteína ligada ao heme, exceto i) nenhuma hemina foi adicionada e ii) etapas extras foram realizadas para remover o ferro e o cobalto do meio de cultura. Um procedimento publicado foi usado e modificado para excluir sais de cobalto da mistura mineral (23).

Expressão do mutante H149A de DevS642

O mutante pode ser expresso como a proteína ligada ao heme e como a apoproteína seguindo o método empregado no caso de DevS642 wt. Para obter a apoproteína, a falta de adição de hemina foi suficiente e nenhuma etapa adicional foi necessária para diminuir a contaminação com a proteína recombinante ligada a heme. A apoproteína do mutante H149A foi obtida usando meio LB.

Purificação de Proteína

As células foram lisadas em tampão fosfato pH 7,6 (NaH 50 mM2PO4, Glicerol a 10%, NaCl 200 mM, Triton X-100 a 1%, lisozima 0,5 mg / mL, inibidores de protease: antipaina 1 & # x003bcg / mL, leupeptina 1 & # x003bcM, pepstatina 1 & # x003bcM, PMSF 0,1 mM). Em seguida, a mistura foi incubada com agitação a 37 & # x000b0C durante 10 min. As membranas celulares foram rompidas por ciclos de sonicação repetidos a 50% usando um sonificador Branson 450 da VWR Scientific, enquanto resfriavam em gelo. A fração insolúvel foi isolada por centrifugação a 35000 rpm por 1 h a 4 & # x000b0C. O lisado celular foi aplicado a uma coluna de armadilha His de 5 mL a uma taxa de 1 mL / min. A coluna foi então lavada com imidazol 20 e 50 mM em tampão fosfato (NaH 50 mM2PO4, Glicerol a 10%, NaCl 500 mM, 50 mL a uma taxa de 2 mL / min). A proteína recombinante eluiu com imidazol 200 mM em tampão fosfato (50 mL, 1 mL / min). A amostra foi então dialisada e as frações que não eram puras foram repurificadas em uma coluna de armadilha de His para fornecer a proteína pura. Este procedimento foi bem-sucedido para o heme contendo DevS642 wt e H149A, e também para a apoproteína do mutante H149A. O tampão foi substituído por tampão Hepes 20 mM (NaCl 150 mM pH 8) para o isolamento de apoDevS642.

Quantificação de Proteína

O teor de proteína para o DevS642 wt foi determinado por análise de aminoácidos na Universidade da Califórnia, Davis. O rendimento da proteína solúvel foi de 16 mg / L de cultura no caso de co-expressão com as proteínas de choque térmico GroEL / ES. O rendimento da proteína solúvel quando expressa sem acompanhantes foi de 2,3 mg / L de cultura.

Determinação de conteúdo heme de Wt DevS642

Hidróxido de sódio 5N (5 & # x003bcL) e piridina (18 & # x003bcL) foram adicionados à amostra de proteína (80 & # x003bcL do complexo férrico). O espectro oxidado foi registrado e, em seguida, ditionito de sódio (alguns cristais) foi adicionado para obter o espectro reduzido. A absorbância em 539 e 556 nm foi usada para determinar o conteúdo de heme de acordo com o protocolo publicado (24). O conteúdo de heme foi determinado em 97%.

Cromatografia de exclusão de tamanho de Wt DevS642

O estado oligomérico da proteína recombinante DevS642 foi estabelecido usando uma coluna Superdex 75 (FPLC) em um sistema tampão de fosfato (fosfato 50 mM, NaCl 200 mM pH 7,6). A absorbância do eluato foi monitorada em dois comprimentos de onda, 280 e 406 nm. Dextran (1 mg / ml) foi usado para determinar o volume vazio. A curva de calibração foi obtida com os seguintes padrões de proteína: albumina (MW 66000, 10 mg / mL), álcool desidrogenase (MW 150000, 5 mg / mL), anidrase carbônica (MW 29000, 3 mg / mL), citocromo c (MW 12400, 2 mg / mL). DevS642 é 96% monomérico (MW 30269 como estimado a partir do ensaio de filtração em gel) e 4% dimérico (MW 61518).

Titulações de heme de Wt ApoDevS642

Uma amostra de proteína 500 & # x003bcL (tipicamente 5 & # x003bcM concentração em Hepes 20 mM, NaCl 150 mM, tampão de glicerol a 10%) foi titulada com uma solução de hemina. Aliquots of 0.5 μL of a 0.106 mg/mL hemin solution were added and the difference spectrum was recorded 10 min after each addition (the reference cuvette contained buffer and the same amounts of hemin.) To obtain the dissociation constant, 𹒫sorbance 407-350 nm was plotted as a function of hemin concentration and the data points in the titration were fit to the following equation: 𹒫sorbance = Amax/1 + KD/[hemin] (25).

Cyanide and Azide Titrations of Wt DevS642

The concentration of DevS642 was determined based on the intensity of the Soret peak at 407 nm. A 500 μL sample (usual concentration 5 μM) was used in these assays. The initial spectrum of the protein in phosphate buffer (50 mM phosphate and 200 mM sodium chloride) was recorded and then difference spectra were acquired 5 min. after each addition (typically 0.5 μL) of the ligand to both the reference cuvette and the cuvette containing the protein solution. Sodium azide and potassium cyanide were prepared as aqueous solutions in the same buffer. The increase in absorbance at 424 nm (cyanide) or 422 (azide) was plotted as a function of ligand concentration and the data were fit to a rectangular hyperbola (the azide titration) or the quadratic tight binding equation in the case of cyanide (26).

Electronic Absorption and Resonance Raman Spectroscopy

Typical enzyme concentrations used were

100� μM. Biomax-10 ultrafiltration devices (Millipore) were used for buffer exchange and for concentrating the protein. Reduction to the ferrous state was achieved by adding microliter aliquots of 25� mM sodium dithionite solution to an argon-purged sample in the Raman capillary cell and was monitored by UV-visible spectroscopy directly in the capillary using a Cary 50 spectrometer. 12 CO (Airgas) and 13 CO (99% 13 C, ICON Stable Isotopes) adducts were obtained by injecting CO through a septum-sealed capillary containing argon-purged, reduced protein (

20 μL). O2 (Airgas), 18 O2 (99% 18 O, ICON Stable Isotopes), NO (Aldrich), and 15 N 18 O (98% 15 N and 95% 18 O, Aldrich) adducts were generated using the same procedure after excess dithionite was removed from the reduced sample with desalting spin columns (Zebra ™ 0.5 mL, Pierce). These procedures were performed in a glovebox with a controlled atmosphere of less than 1-ppm of O2 (Omni-Lab System, Vacuum Atmospheres Company). RR spectra were obtained using a custom McPherson 2061/207 spectrograph (0.67 m with variable gratings) equipped with a Princeton Instruments liquid N2-cooled CCD detector (LN-1100PB). Kaiser Optical supernotch filters were used to attenuate Raleigh scattering. A Krypton laser (Innova 302, Coherent) and a He/Cd laser (Liconix 4240NB) were used for the 413- and 442-nm excitations, respectively. Spectra were collected in a 90° scattering geometry on samples at room temperature. Frequencies were calibrated relative to indene and CCl4 and are accurate at ଑ cm 𢄡 . CCl4 was also used to check the polarization conditions. The integrity of the RR samples, before and after laser illumination, was confirmed by direct monitoring of their UV-visible spectra in the Raman capillaries.


Conclusão

Complications in E. coli-related infection have been mainly attributed to biofilm formation. Biofilm is considerably recalcitrant to antibiotics as compared to its planktonic culture. Escherichia coli biofilm formation is an intricate process which involves a number of steps such as initial adhesion, early development, maturation and dispersion. These steps are governed by a number of genes that serve specific functions in the formation of the biofilm. Type I fimbriae of E. coli plays a crucial role in its attachment to the surface and maturation is further facilitated by autotransporters and EPS. Recent discoveries have also identified stress resistance genes in the biofilm-formation process that help the biofilm to survive in hostile environments. o rpoS gene is majorly responsible for regulating genes and structural proteins involved in the synthesis and degradation of biofilm, under stress conditions.

Escherichia coli biofilm has been found to be resistant to a number of antibiotics, mostly accredited to putative multidrug resistance pump. The development of the extracellular matrix and the observed increased resistance to common antibiotics create a challenge to control the infections caused by E. coli biofilms. Recently there have been advances in exploring and developing new approaches and therapeutic methods to cure E. coli biofilm-related infections.

Molecular and structural understanding of E. coli biofilm has led to the advances in targeting specific agents to curtail infections. Type I pili of E. coli are crucial for the adhesion and initiation of E. coli biofilm formation. The curlicides and pilicides have been designed against curli subunit protein CsgA and type I pili, respectively, and have been shown to inihibit bacterial biofilm. The combination of phages have shown to complement lysis of bacteria through different mechanism of action and yielded promising results. Bacterial biofilm has been notorious in mounting resistance and phytochemicals and AMPs are able to address this issue through their diverse mechanism to target organisms.

One of the major problems faced by these remedial agents is stability and low bioavailability. Natural compound efficacy can be improved by incorporating them in nanoparticles or coating on a particular surface. Silver nanoparticles have shown great promise especially in coating the medical devices and wound dressings and were found to be effective against E. coli biofilm both em vitro e na Vivo mouse model. An antimicrobial nanospray JUC, which was sprayed on a catheter was found to be efficacious in restricting E. coli biofilm formation. These new methods hold a great promise but the issues concerning na Vivo efficacy, toxicity and large-scale production need to be addressed before these potential therapeuticals can reach the clinical stage.


Reconhecimentos

We acknowledge funding by the Bundesministerium für Wirtschaft und Technologie within the framework of Zentrales Innovationsprogramm Mittelstand (ZIM). We also wish to thank Steffen Wagner and Stefan Ortleb for excellent technical assistance.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

Fig. S1 The influence of PFD immersion on the photosynthetic output of a sycamore leaf.

Fig. S2 The effect of the photosynthesis inhibitor DCMU on light-dependent oxygen production in the sycamore leaf.

Observação: O editor não é responsável pelo conteúdo ou funcionalidade de qualquer informação de suporte fornecida pelos autores. Quaisquer dúvidas (que não sejam de conteúdo ausente) devem ser direcionadas ao autor correspondente do artigo.


Assista o vídeo: Dr CARRO Sensor de Oxigênio - Consumo alto e falhas intermitentes (Dezembro 2022).