Em formação

Os bloqueadores dos canais de potássio afetam o potencial de membrana em repouso?

Os bloqueadores dos canais de potássio afetam o potencial de membrana em repouso?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estou lendo sobre venenos e toxinas de escorpião para minha aula de biologia e eles parecem ter uma variedade de bloqueadores dos canais de potássio. Meu professor perguntou "Que efeito isso teria em um neurônio?" e, naturalmente, duas coisas vieram à mente

  1. Os canais de potássio são necessários para a repolarização
  2. Os canais de potássio participam do controle do gradiente de concentração da célula.

Encontrei evidências em artigos que apóiam a primeira afirmação, mas não sei muito sobre a segunda.

Os bloqueadores dos canais de potássio afetam o potencial de membrana em repouso? Eles alterariam significativamente o gradiente de concentração?


  1. Os canais de potássio participam do controle do gradiente de concentração da célula.

Eu reformularia isso para "Sódio / potássio bombas estabelecer os gradientes de concentração de sódio e potássio através da membrana celular. "Potássio canais não.

Encontrei evidências em artigos que apóiam a primeira afirmação, mas não sei muito sobre a segunda.

Direito; porque os canais não configuram gradientes de concentração.

Os bloqueadores dos canais de potássio afetam o potencial de membrana em repouso?

Se eles bloquearem os canais de potássio de "vazamento" do estado de repouso, pode apostar. O potencial de repouso da membrana é amplamente definido pela condutância elétrica através desses canais. Bloqueá-los despolarizaria muito a célula em comparação com os valores típicos de potencial de membrana em repouso. Mas existem muitos canais de potássio diferentes. Você pode estar pensando em bloquear o canal de potássio retificador retardado, o que não deve fazer muito para alterar o potencial de membrana em repouso.

Eles alterariam significativamente o gradiente de concentração?

Provavelmente não, pois embora a célula estaria perdendo menos potássio por meio dessa condutância, o que mais importa para o gradiente de concentração de potássio são as bombas sódio / potássio.


Resposta curta
O veneno de escorpião afeta principalmente a atividade de disparo neuronal, inibindo a recuperação.

Fundo
Existem cerca de 100 subtipos de K+ canais e cerca de 120 toxinas de escorpião diferentes conhecidas. Desse host de toxinas, a maioria foi testada em canais relacionados a Shaker (subfamília KV1.x). Alguns peptídeos foram mostrados para agir sobre o Ca2+-ativado K+ canais (KCa1.1, KCa3.1, KCa2.x. A família das chamadas toxinas g-KTx é específica para a família ether-a-go-go de K+ canais (KV11.x) (Rodriguez de la Vega & Possani, 2004).

A subfamília Shaker e a família ether-a-go-go são todos canais dependentes de voltagem e, portanto, intimamente envolvidos na geração de potencial de ação (Coleman et al., 1999; Shepard et al., 2007)]; o CA2+-ativado K+ canais são ativados quando Ca2+ entra na célula, que é um evento tipicamente associado a potenciais de ação também.

Portanto, com base nessas informações, concluo que o veneno de escorpião bloqueia principalmente a fase de repolarização dos neurônios, o que significa que a taxa máxima de disparo será drasticamente reduzida porque a recuperação é bloqueada. Os neurônios podem disparar, mas não serão capazes de se recuperar do disparo contínuo.

O veneno do escorpião não está fortemente associado aos canais de vazamento de potássio (família KCNK). Embora outras famílias também possam afetar o potencial de membrana em repouso, é a família KNCK que está mais associada à geração do potencial de membrana em repouso celular (Cohen et al., 2009). portanto, o veneno de escorpião não afetará muito o potencial de membrana em repouso.

Referências
- Coleman et al., J Neurochem (1999); 73: 849-58
- Rodriguez de la Vega & Possani, Toxicon (2004); 43: 865-875
- Shepard et al., Boletim de Esquizofrenia; 33(6): 1263-9
- Cohen et al., Eur Biophys J (2009); 39(1): 61-73


O que acontece se os canais de vazamento de sódio forem bloqueados?

Mais Na + controlado por voltagem canais estão sendo bloqueado nas células despolarizadas. Esta repolarização redefine os portões de ativação e inativação do canal de sódio, permitindo que uma célula gere outro potencial de ação (Na + canais só pode abrir a partir do estado fechado, não a partir do estado inativado).

Também se pode perguntar: o que acontece com o potencial de membrana em repouso de uma célula se os canais de vazamento de K + forem bloqueados? Isso vai reduzir o potencial de membrana em repouso, Fazendo o célula menos negativo (ou mais positivo). Na voltagem controlada canais que permitem Na para vazar No célula, fazendo célula mais positivo.

Além disso, o que acontece com o potencial de ação quando os canais de potássio são bloqueados?

Efeitos em potenciais de ação O papel principal de canais de potássio no coração potenciais de ação é a repolarização celular. Portanto, bloqueio esses canais retarda (atrasa) a repolarização, o que leva a um aumento na potencial de acção duração e um aumento do período refratário efetivo (ERP).

Existem canais de vazamento de sódio?

A membrana celular do neurônio é parcialmente permeável a sódio íons, então sódio átomos lentamente vazar no neurônio através de canais de vazamento de sódio. A célula quer manter um potencial de membrana em repouso negativo, por isso tem uma bomba que bombeia o potássio de volta para a célula e bombeia sódio fora da célula ao mesmo tempo.


Epilepsias de excitação-inibição

36.5.2.5 Flupirtina

A flupirtina, um abridor seletivo do canal de potássio neuronal, ativa os canais KCNQ (canais de K + retificadores internos regulados pela proteína G) e estabiliza o potencial de membrana em repouso. A flupirtina também atua por meio do antagonismo do receptor NMDA, aumentando o bloqueio do Mg 2 + (Kornhuber et al., 1999). As propriedades anticonvulsivantes da flupirtina foram estudadas apenas recentemente. A flupirtina provou ser bem-sucedida em suprimir completamente as convulsões no modelo de flurotila de convulsões neonatais e na prevenção de convulsões eletrográficas e comportamentais no modelo SE induzido por ácido cainico em ratos P10 (Raol et al., 2009). Mais estudos são necessários para determinar os efeitos de longo prazo do tratamento com flupirtina nas convulsões neonatais.


O tratamento com o ativador do canal de potássio Kv7 flupirtina é benéfico em dois modelos independentes de camundongos de hipertensão pulmonar

Antecedentes e propósito: Canais de potássio dependentes de voltagem (K (v)) contribuem para o potencial de membrana em repouso nas células musculares lisas da artéria pulmonar e são regulados para baixo em pacientes com hipertensão arterial pulmonar (HAP) e uma contribuição dos canais K (v) 7 foi recentemente proposta. Nós investigamos o efeito do ativador do canal K (v) 7, flupirtina, sobre a PAH em dois modelos de camundongos independentes: PAH induzida por hipóxia e PAH espontânea em camundongos com superexpressão do transportador 5-HT (SERT (+) camundongos).

Abordagem experimental: A pressão ventricular direita foi avaliada in vivo em camundongos cronicamente tratados com flupirtina (30 mg.kg (-1) .dia (-1)). Em experimentos in vitro separados, as artérias pulmonares de camundongos não tratados foram montadas em um miógrafo de fio. Foram medidos relaxamentos à administração aguda de flupirtina e contrações a drogas bloqueadoras dos canais K (v), incluindo o bloqueador de canais K (v) 7 linopirdina.

Resultados principais: Em camundongos do tipo selvagem (WT), a hipóxia aumentou a pressão ventricular direita, remodelação vascular pulmonar e hipertrofia ventricular direita. Esses efeitos foram atenuados pela flupirtina, que também atenuou esses índices de HAP em camundongos SERT (+). Nos experimentos in vitro, a flupirtina induziu uma potente resposta relaxante nas artérias de camundongos WT e SERT (+) não tratados. O relaxamento foi totalmente revertido pela linopirdina, que contraiu potentemente as artérias pulmonares de camundongos, enquanto outros bloqueadores do canal K (v) não.

Conclusões e implicações: A flupirtina atenuou significativamente o desenvolvimento de HAP induzida por hipóxia crônica em camundongos e reverteu a HAP estabelecida em camundongos SERT (+), aparentemente por meio da ativação do canal K (v) 7. Esses resultados fornecem a primeira evidência direta de que as drogas que ativam os canais K (v) 7 podem ser benéficas no tratamento da HAP com diferentes etiologias.


Efeitos dos abridores dos canais de potássio e seus antagonistas nos neurônios locus coeruleus de ratos.

1. Registros intracelulares foram obtidos a partir de uma preparação de corte pontino do cérebro de rato contendo o locus coeruleus (LC). Dois abridores de canais de potássio sensíveis ao ATP (K (ATP)), RO 31-6930 (10 microM) e cromakalim (100 microM) diminuíram a descarga espontânea de potenciais de ação sem alterar sua amplitude ou duração. Nenhum dos compostos alterou o potencial de membrana em repouso. 2. Dos dois bloqueadores do canal K (ATP), a tolbutamida (300 microM) aumentou a taxa de disparo, enquanto a glibenclamida (3 microM) apenas tendeu a fazê-lo. Além disso, ambos os compostos antagonizaram o efeito de RO 31-6930 (10 microM). Nem a glibenclamida (3 microM) nem a tolbutamida (300 microM) alteraram o potencial de membrana em repouso. 3. A tetrodotoxina (0,5 microM) deprimiu o disparo, mas não influenciou a ação inibitória de RO 31-6930 (10 microM). O antagonista do aminoácido excitatório, ácido quinurênico (500 microM), não alterou a descarga espontânea dos potenciais de ação. 4. Pequenos desvios (2-4 mV) do potencial de membrana por meio de injeções de corrente hiper ou despolarizantes diminuíram e aumentaram a taxa de disparo, respectivamente. 5. A noradrenalina (100 microM) hiperpolarizou as células e diminuiu sua resistência de entrada. Este efeito não foi antagonizado por glibenclamida (3 microM) ou tolbutamida (300 microM). Ba2 + (2 mM), um bloqueador de ambos os canais de potássio sensíveis a ATP e retificadores internos, aboliu os efeitos de RO 31-6930 (10 microM) e noradrenalina (100 microM). 6. Esses dados sugerem que os canais K (ATP) estão presentes nos neurônios LC noradrenérgicos, mas não estão acoplados aos adrenoceptores alfa 2.


MATERIAIS E MÉTODOS

Expressão em oócitos de X. laevis

X. laevis os oócitos foram preparados, injetados e desfoliados, conforme descrito anteriormente (21, 22). RNA codificador poliadenilado (cRNA) para proteína codificada pelo gene Tb927.1.4450 (TbK1) e proteína codificada pelo gene Tb927.9.4820 (TbK2) foi preparado in vitro com o kit mMESSAGE mMACHINE (Ambion, Austin, TX, EUA). Os oócitos foram injetados com solução de 50 nl contendo cRNA, codificando para TbK1 ou TbK2 ou uma mistura 1: 1 de ambos (0,2 μg / μl cada) e, em seguida, incubados em solução de Barth modificada [HEPES 10 mM, pH 7,5, NaCl 88 mM, 1 mM KC1, 2,4 mM NaHCO3, MgSO 0,82 mM4, 0,34 mM Ca (NO3)2, CaCl 0,41 mM2, 100 unidades / ml de penicilina, 100 μg / ml de estreptomicina] a 18 ° C por 3 dias antes das medições.

Caracterização funcional em oócitos de X. laevis

As medições de corrente foram realizadas usando um amplificador de pinça de tensão de 2 eletrodos Oocyte Clamp OC-725 (Warner Instruments, Hamden, CT, EUA). As correntes foram digitalizadas a 10 kHz com MacLab / 200 (AD Instruments, Spechbach, Alemanha).

Os experimentos eletrofisiológicos foram realizados em um potencial de retenção de -40 mV. Com uma frequência de 1 Hz, foram aplicados passos de tensão discretos de 300 ms de duração a potenciais variando de -120 a +40 mV em passos de 10 mV. O meio de perfusão continha 90 mM NaCl, 1 mM KC1,1 mM MgCl2, CaCl 1 mM2e Na-HEPES 5 mM (pH 7,4). A solução de perfusão (6 ml / min) foi aplicada através de um capilar de vidro com diâmetro interno de 1,35 mm, cuja boca foi colocada

0,5 mm da superfície do ovócito (23). Quando o potássio foi usado como o cátion principal, o meio continha 91 mM KC1,1 mM MgCl2, CaCl 1 mM2e K-HEPES 5 mM (pH 7,4). Para a determinação da seletividade de íons do canal, um meio adicional com N-metil-d-glucamina (NMDG) como um cátion principal foi usado. Este meio continha 90 mM NMDG, 1 mM KCl, 1 mM MgCl2, CaCl 1 mM2e K-HEPES 5 mM (pH 7,4).

Para a determinação da seletividade de íons, a equação de Goldman-Hodgkin-Katz (24, 25) foi usada da seguinte forma: EN / D = -89mV = 58,8mV-log ((pN / D·[N / DFora] + pK· [KFora] + pCr [Clno]) / x), [NaFora] = 92,5 mM, [KFora] = 1 mM EK = -24 mV = 58,8 mV · log ((PN / D· [N / DFora] + pK· [KFora] + pCr [Clno]) / x), [NaFora] = 0 mM, [KFora] = 93,5 mM ENMDG ∗ = -96 mV = 58,8 mV · log ((pN / D· [N / DFora] + PK· [KFora] + PNMDG ∗ [NMDGFora] + pG ∗ [Clno]) / x), [NaFora] = 0 mM, [KFora] = 3,5 mM, [NMDGFora] = 90 mM. [Clno] foi determinado como 30 mM a partir do potencial de reversão de oócitos que expressam GABA seletivo de cloreto recombinante ativado por GABAUMA canais. pNMDG foi considerado insignificante. PK/ PN / D pode então ser calculado como 22. Em oócitos de controle com injeção de água, EN / D, EK, e ENMDG foram, em média, -21, -9 e -36 mV, respectivamente. PK/ PN / D pode ser calculado como 2,2 neste caso. Como a membrana contém, além das condutâncias endógenas TbK1 / TbK2 com essa seletividade baixa, uma seletividade iônica de 22 para a corrente mediada por TbK1 / TbK2 é uma subestimativa.

Silenciamento de gene mediado por RNAi

A expressão de TbK1 e TbK2 foi regulada negativamente por RNAi pelo uso de uma construção de haste-alça contendo um gene de resistência à puromicina (para PCF) ou à fleomicina (para BSF). A seleção das sequências de genes para o RNAi foi feita com o RNAit, um algoritmo de predição projetado para prevenir a interferência potencial e, portanto, os efeitos fora do alvo (26).

Com o iniciador direto GCCCAAGCTTGGATCCTTTCAGTCTCACGCCTTCCT e o iniciador reverso CTGCTCTAGAGTCGAGCCGAATATGTCGTAGGGGAA, um fragmento de 425 bp abrangendo os nucleotídeos 2321-2746 de TbK1 foi amplificado por PCR e clonado nos vetores alvo. Para TbK2, um fragmento de 502 pb, incluindo os nucleotídeos 60-562 do gene, foi amplificado com o iniciador direto GCCCAAGCTTGGATCCCTTCCGAAATTTGTTTGATG e o iniciador reverso CTGCTCTAGACTCGAGTATACCAACACACGTGGAGA e clonado nos vetores alvo. Para a transfecção de PCF, o plasmídeo pALC14 (um gentil presente de André Schneider, University of Bern, Suíça) foi escolhido, e para BSF, o vetor pMS14v5 (27) foi usado. O plasmídeo pMS14v5 foi gerado por digestão de restrição da região haste-alça do plasmídeo pALC14 (28) pelo uso de HindIII e BamHI, seguido pela ligação da alça da haste no locus correspondente do vetor pLEW100v5bld (29), permitindo a expressão induzível por tetraciclina de um RNA em grampo sob um promotor de rRNA. Antes da transfecção de T. brucei células, o DNA de plasmídeo foi linearizado com NãoI e extraído com fenol e clorofórmio.

Transfecção estável de tripanossomas e seleção de clones

T. brucei As células 29-13 PCF (30) foram cultivadas até a fase midlog (0,5-0,8 × 10 7 células / ml) em meio de cultura para PCF (SDM-79 BioConcept, Allschwil, Suíça), suplementado com 10% (v / v) fetal soro bovino (FBS LuBioScience GmbH, Lucerne, Suíça) a 27 ° C. As células (4-5 × 10 7) foram colhidas por centrifugação a 1250 g por 10 minutos, lavado uma vez em tampão (NaCl 132 mM, KC1 8 mM, Na 8 mM2HPO4, KH 1,5 mM2PO4, Acetato de magnésio 0,5 mM, acetato de cálcio 0,09 mM, pH 7,0), ressuspenso em 450 μl do mesmo tampão e misturado com 15 μg de plasmídeo linearizado. A eletroporação foi realizada com um sistema BTX Electroporation 600 (Axon Laboratories, Baden, Suíça) com 1 pulso (tensão de carga de 1,5 kV, resistência de 2,5 kV, tempo de capacitância de 25 mF e tempo de resistência de 186 Ω) pelo uso de uma cuvete de pulso de 0,2 cm ( Bio-Rad Laboratories AG, Cressier, Suíça). As células eletroporadas foram inoculadas imediatamente em 10 ml de SDM-79 contendo 10% de FBS inativado pelo calor. Os clones foram obtidos por diluição limitada em placas de 24 poços em SDM-79 contendo 20% de meio condicionado na presença de 2 μg / ml de puromicina para seleção. Os clones resistentes a antibióticos foram testados quanto à presença das construções introduzidas por PCR. O RNAi foi induzido pela adição de 1 μg / ml de tetraciclina às culturas de parasitas. A cepa parental NYsm (30) da corrente sanguínea foi cultivada em um meio de cultura para meio BSF (HMI-9), suplementado com 10% (v / v) de FBS inativado por calor e 1 μg / ml de G418 até a fase midlog (0,5-0,8 × 10 6 células / ml). Em seguida, 4-5 x 10 7 células foram colhidas por centrifugação, lavadas e ressuspensas em tampão (Na 90 mM2HPO4, KCl 5 mM, CaCl 0,15 mM2, HEPES 50 mM, pH 7,3) e 15 μg de plasmídeo linearizado. A eletroporação foi realizada com o programa Z-001 no Amaxa Nucleofector 2b (Lonza, Visp, Suíça). Os clones foram obtidos por diluição limitada em placas de 24 poços em HMI-9 contendo FBS a 10% na presença de 1 μg / ml de fleomicina para seleção. Os clones resistentes a antibióticos foram testados quanto à presença das construções introduzidas por PCR. As condições para ambas as transfecções foram escolhidas de acordo com um protocolo publicado anteriormente (31).

Isolamento de RNA e RT-PCR quantitativo

O RNA total foi extraído de culturas de RNAi induzidas e não induzidas em vários momentos, de acordo com o protocolo do fabricante, usando o SV Total RNA Extraction Kit (Promega, Madison WI, EUA). A concentração e a pureza do RNA foram medidas com um espectrofotômetro (NanoDrop 1000 Thermo Fisher Scientific, Wilmington, DE, EUA), e 10 μg de RNA total de cada ponto de tempo foi submetido a um segundo tratamento com DNase I (Roche, Basel, Suíça). Posteriormente, o RNA foi purificado por extração com fenol / clorofórmio e posterior precipitação. A concentração de RNA foi novamente determinada com um espectrofotômetro (NanoDrop 1000 Thermo Fisher Scientific), e 2 μg de RNA total foram usados ​​para uma transcrição reversa com primers aleatórios pelo uso do High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life Technologies, Paisley, United Reino). O cDNA resultante foi diluído nas concentrações desejadas e analisado por PCR quantitativo (qPCR) por meio do Kit Fast SYBR Green (Applied Biosystems, Life Technologies), de acordo com as instruções do fabricante. Como controle interno validado, os níveis de expressão de Tb11.01.1950 foram medidos em paralelo (32). Os primers específicos para cada alvo foram desenhados com a ferramenta Primer3Plus (33). Os primers direto e reverso usados ​​para TbK1 foram ATGATGGGTCGTTGCTTCTC e ATACAACGATTCCGGTGAGC, respectivamente. Para TbK2, o primer direto usado foi TCCACTGTTTGGAGATGCAG, e o primer reverso foi ATCCTATGCGGGTTGAGTTG. Para Tb11.01.1950, usamos os primers publicados por Brenndörfer e Boshart (32). Cada amostra foi analisada em triplicata e o ciclo de limiar médio (CT) foi calculado para cada amostra. Os níveis de expressão relativa dos genes alvo foram determinados pelo método 2 -ΔΔCT (34).

Citometria de fluxo

As células da forma de corrente sanguínea (8 x 10 5 / l ml de amostra) foram incubadas a 37 ° C em 30 mM NTampão de ácido - [tris (hidroxirnetil) rnetilil] -2-aminoetanossulfônico, NaCl 118 mM, NaHCO 5 mM3, 5 mM KCl, 1,2 mM MgCl2e glicerol 10 mM, pH 7,4, durante 90 minutos. Posteriormente, foram realizados os experimentos de citometria de fluxo. Após adição de ácido bis- (1,3-dibutilbarbitúrico) trimetina [DiBAC4(3) Invitrogen, Molecular Probes, Eugene, OR, USA] para uma concentração final de 20 nM, a fluorescência basal foi determinada, seguida por um aumento sucessivo na concentração total de KCl ou NaCl de 5, 10,20 e 40 mM em ambos os casos, e uma medição após cada adição. Finalmente, a gramicidina (Sigma-Aldrich Chemie GmbH, Buchs SG, Suíça) foi adicionada a uma concentração final de 1 μM. As amostras foram incubadas por 5 minutos a 37 ° C, e a fluorescência foi determinada novamente. Uma calibração do potencial de membrana que usa o ionóforo seletivo de potássio valinomicina não pôde ser feita, uma vez que este ionóforo interage com compostos oxonol (35). Para cada medição, pelo menos 10.000 células foram analisadas. Os dados foram analisados ​​com o software FlowJo (TreeStar, Ashland, OR, EUA). A análise estatística foi realizada com uma ANOVA unilateral com um Bonferroni post hoc teste.


Como e o que bloqueiam os bloqueadores dos canais de potássio e cálcio?

Muitos pacientes podem ouvir que a medicação que seu médico está prescrevendo é um bloqueador dos canais de sódio, beta-bloqueadores, bloqueadores dos canais de potássio ou bloqueadores dos canais de cálcio, sem que lhes digam qual é a diferença, por que ou como funcionam tão bem. Os pacientes podem estar se perguntando. Beta é a carta da minha fraternidade que voltou para me assombrar depois de todos esses anos? Conforme mostrado no blog anterior e será posteriormente representado neste blog, sódio, "Beta", potássio e cálcio não são algumas moléculas do mal que saem para pegar o seu coração. Eles são aspectos muito vitais de suas funções corporais, mas às vezes podem ficar superestimulados, causar arritmias e esses bloqueadores de canais estranhos tornam-se exatamente o que o médico prescreve. No blog anterior, analisei os bloqueadores dos canais de sódio e beta. Aqui, discutirei os bloqueadores dos canais de potássio e cálcio.

Classe III: bloqueadores do canal de potássio
Potenciais de ação e o papel do potássio nos potenciais de ação
Lembra-se dos potenciais de ação discutidos com os canais de sódio? O início do potencial de ação começa com a despolarização da membrana celular quando o sódio entra. A célula começa a se repolarizar quando o potássio sai da célula, embora não tão rapidamente quanto o sódio entra. Essa repolarização leva a membrana celular de volta a um nível de potencial de repouso mais negativo.

O que um bloqueador do canal de potássio bloqueia e para que é usado para tratar
Os bloqueadores dos canais de potássio se ligam e bloqueiam os canais de potássio responsáveis ​​pela repolarização da membrana celular. O bloqueio desses canais retarda (retarda) a repolarização, o que leva a um aumento na duração do potencial de ação e um aumento no período refratário efetivo. Um aumento no período refratário significa que o período de tempo em que a célula não é excitável e, portanto, não pode receber outro potencial de ação, é prolongado. Em um eletrocardiograma, esse retardo da despolarização aumenta o intervalo QT.

Ao tornar a célula menos excitável, os bloqueadores dos canais de potássio são muito eficazes no tratamento de taquicardias. Eles também são conhecidos por tratar arritmias supraventriculares e ventriculares, fibrilação atrial e flutter atrial.

Exemplos de bloqueadores do canal de potássio e seus efeitos colaterais
Amiodarona, Dronedarona, Bretílio, Ibutilida, Dofetilida

Os efeitos colaterais dos bloqueadores dos canais de potássio são a produção de um tipo de taquicardia ventricular, bradicardia e bloqueio atrioventricular ou disfunção do nó SA. Converse com seu médico e farmacêutico para descobrir qual é o medicamento certo para você. E não se esqueça de avaliar o medicamento em www.RateaDrug.com para que outras pessoas saibam quais experiências você teve com um medicamento específico!

Classe IV: bloqueadores dos canais de cálcio
O que são canais de cálcio e onde eles são encontrados
Os canais de cálcio são células conhecidas como "células excitáveis", que são sensíveis aos impulsos elétricos. Como os canais de sódio e potássio, quando as proteínas recebem o sinal correto, o canal se abre, permitindo que o cálcio flua através do canal. A pequena carga que o íon cálcio carrega pode estimular as contrações musculares, a liberação de hormônios ou o disparo de um neurotransmissor. Portanto, os canais de cálcio são encontrados nos músculos, células gliais e neurônios.

O que bloqueia um bloqueador do canal de cálcio e para que é usado para tratar
Os bloqueadores dos canais de cálcio dilatam as artérias do coração, reduzindo a pressão sanguínea nas artérias, o que faz com que o coração seja capaz de bombear o sangue com mais facilidade. Essencialmente, a necessidade de oxigênio do coração para bombear o coração é reduzida porque ele não precisa bombear com tanta frequência.

Os bloqueadores dos canais de cálcio costumam ser usados ​​para hipertensão, dor no peito (devido à falta de oxigênio no coração) e arritmias, como fibrilação atrial e taquicardia supraventricular. Eles podem ser usados ​​após um ataque cardíaco em um paciente que não seja um bom candidato ao uso de betabloqueadores. Infelizmente, os bloqueadores dos canais de cálcio não mostraram prevenir futuros ataques cardíacos.

Exemplos de bloqueadores do canal de cálcio e seus efeitos colaterais
Amlodipina, Diltiazem (Marca = Cardizem), Felodipina, Nifedipina, Nicardipina, Nimodipina, Nisoldipina, Verapamil


Conteúdo

Foi demonstrado que as dendrotoxinas bloqueiam subtipos específicos de canais de potássio dependentes de voltagem (K +) no tecido neuronal. [ citação necessária ] No sistema nervoso, os canais de K + dependentes de voltagem controlam a excitabilidade dos nervos e músculos, controlando o potencial de membrana em repouso e repolarizando a membrana durante os potenciais de ação. Foi demonstrado que a dendrotoxina liga os nódulos de Ranvier dos neurônios motores [1] e bloqueia a atividade desses canais de potássio. Desse modo, as dendrotoxinas prolongam a duração dos potenciais de ação e aumentam a liberação de acetilcolina na junção neuromuscular, o que pode resultar em hiperexcitabilidade muscular e sintomas convulsivos.

Proteínas de 7kDa consistindo em uma única cadeia peptídica de aproximadamente 57-60 aminoácidos. Vários homólogos de alfa-dendrotoxina foram isolados, todos possuindo uma sequência ligeiramente diferente. No entanto, a arquitetura molecular e a conformação de dobramento dessas proteínas são muito semelhantes. As dendrotoxinas possuem um 3 muito curto10-hélice perto do terminal N do peptídeo, enquanto uma hélice alfa de duas voltas ocorre perto do terminal C. Uma folha β antiparalela de duas cadeias ocupa a parte central da estrutura molecular. Essas duas fitas β são conectadas por uma região de volta β distorcida [2] que é considerada importante para a atividade de ligação da proteína. Todas as dendrotoxinas são reticuladas por três pontes dissulfeto, que adicionam estabilidade à proteína e contribuem muito para sua conformação estrutural. Os resíduos de cisteína que formam essas ligações dissulfeto foram conservados entre todos os membros da família dendrotoxina e estão localizados em C7-C57, C16-C40 e C32-C53 (numeração de acordo com alfa-dendrotoxina).

As dendrotoxinas são estruturalmente homólogas aos inibidores de serina protease do tipo Kunitz, incluindo o inibidor de tripsina pancreática bovina (BPTI). Alfa-dendrotoxina e BPTI mostraram ter identidade de sequência de 35%, bem como ligações dissulfeto idênticas. Apesar da homologia estrutural entre essas duas proteínas, as dendrotoxinas não parecem exibir qualquer atividade de protease inibitória mensurável como BPTI. Esta perda de atividade parece resultar da ausência de resíduos de aminoácidos chave que produzem diferenças estruturais que impedem as interações chave necessárias para a atividade de protease observada no BPTI.

As dendrotoxinas são proteínas básicas que possuem uma carga líquida positiva quando presentes em pH neutro. A maioria dos resíduos de aminoácidos carregados positivamente das dendrotoxinas estão localizados na parte inferior da estrutura, criando um domínio catiônico em um lado da proteína. A carga positiva resulta de resíduos de lisina (Lys) e arginina (Arg) que estão concentrados em três regiões primárias da proteína: perto do terminal N (Arg3, Arg4, Lys5), perto do terminal C (Arg54, Arg55) e em a região de volta β estreita (Lys28, Lys29, Lys30). [3] Acredita-se que esses resíduos carregados positivamente podem desempenhar um papel crítico na atividade de ligação da dendrotoxina, pois eles podem fazer potenciais interações com os locais aniônicos (aminoácidos carregados negativamente) nos poros dos canais de potássio.

Farmacologia Editar

Uma única molécula de dendrotoxina associa-se reversivelmente a um canal de potássio para exercer seu efeito inibitório. É proposto que essa interação é mediada por interações eletrostáticas entre os resíduos de aminoácidos carregados positivamente no domínio catiônico da dendrotoxina e os resíduos carregados negativamente no poro do canal iônico. Acredita-se que os canais de potássio, semelhantes a outros canais seletivos de cátions, tenham uma nuvem de cargas negativas que precedem a abertura do poro do canal que ajuda a conduzir os íons de potássio através da via de permeação. Em geral, acredita-se (embora não seja provado) que as moléculas de dendrotoxina se ligam a locais aniônicos próximos à superfície extracelular do canal e obstruem fisicamente o poro, evitando assim a condutância iônica. No entanto, Imredy e MacKinnon [4] propuseram que a delta-dendrotoxina pode ter um local de ligação fora do centro em suas proteínas-alvo e pode inibir o canal alterando a estrutura do canal, em vez de bloquear fisicamente o poro.

Resíduos biologicamente importantes Editar

Muitos estudos tentaram identificar quais resíduos de aminoácidos são importantes para a atividade de ligação das dendrotoxinas aos seus alvos do canal de potássio. Harvey et al. [5] usaram modificações específicas de resíduos para identificar resíduos carregados positivamente que eram cruciais para a atividade de bloqueio da dendrotoxina-I. Eles relataram que a acetilação de Lys5 perto da região N-terminal e Lys29 na região de volta beta levou a diminuições substanciais na afinidade de ligação DTX-I. Resultados semelhantes foram mostrados com dendrotoxina-K usando mutagênese dirigida ao local para substituir resíduos de lisina e arginina carregados positivamente por alaninas neutras. Estes resultados, juntamente com muitos outros, implicaram que as lisinas carregadas positivamente na metade N-terminal, particularmente Lys5 na metade10-hélice, desempenha um papel muito importante na ligação da dendrotoxina aos seus alvos do canal de potássio. Os resíduos de lisina na região de volta β forneceram resultados mais confusos, parecendo ser biologicamente críticos em alguns homólogos da dendrotoxina e desnecessários para outros. Além disso, a mutação de todo o tripleto de lisina (K28-K29-K30) em Ala-Ala-Gly em alfa-DTX resultou em muito pouca alteração na atividade biológica.

Há um acordo geral de que o resíduo de lisina conservado perto do terminal N (Lys5 em alfa-DTX) é crucial para a atividade biológica de todas as dendrotoxinas, enquanto resíduos adicionais, como aqueles na região de volta beta, podem desempenhar um papel na especificidade da dendrotoxina pela mediação das interações de toxinas individuais com seus locais-alvo individuais. Isso não apenas ajuda a explicar a estrita especificidade de algumas dendrotoxinas para diferentes subtipos de canais de K + dependentes de voltagem, mas também explica as diferenças na potência das dendrotoxinas para canais de K + comuns. Por exemplo, Wang et al. [6] mostraram que a interação de dendrotoxina-K com KV1.1 é mediado por seus resíduos de lisina no N-terminal e na região de volta β, enquanto a alfa-dendrotoxina parece interagir com seu alvo apenas através do N-terminal. Este domínio interativo menos expansivo pode ajudar a explicar porque a alfa-dendrotoxina é menos discriminativa, enquanto a dendrotoxina-K é estritamente seletiva para KV1.1.

Os canais de potássio dos neurônios de vertebrados exibem um alto grau de diversidade que permite aos neurônios ajustar com precisão suas propriedades de sinalização elétrica pela expressão de diferentes combinações de subunidades dos canais de potássio. Além disso, porque regulam o fluxo iônico através das membranas biológicas, são importantes em muitos aspectos da regulação celular e da transdução de sinal de diferentes tipos de células. Portanto, os canais de potássio dependentes de voltagem são alvos para uma ampla gama de toxinas biológicas potentes de organismos como cobras, escorpiões, anêmonas-do-mar e caramujos cônicos. Assim, a purificação do veneno levou ao isolamento de toxinas peptídicas, como as dendrotoxinas, que se tornaram ferramentas farmacológicas úteis para o estudo dos canais de potássio. Devido à sua potência e seletividade para diferentes subtipos de canais de potássio, as dendrotoxinas tornaram-se úteis como sondas moleculares para o estudo estrutural e funcional dessas proteínas. Isso pode ajudar a melhorar nossa compreensão das funções desempenhadas por tipos de canais individuais, bem como auxiliar na classificação farmacológica desses diversos tipos de canais. [7] Além disso, a disponibilidade de dendrotoxinas marcadas radioactivamente fornece uma ferramenta para o rastreio de outras fontes na procura de novas toxinas dos canais de potássio, como a classe calicludina das toxinas dos canais de potássio nas anémonas do mar. Por último, a informação estrutural fornecida pelas dendrotoxinas pode fornecer pistas para a síntese de compostos terapêuticos que podem ter como alvo classes específicas de canais de potássio. A dendrotoxina I também tem sido usada para ajudar a purificar e caracterizar a proteína do canal de K + à qual se liga por meio de diferentes ensaios de ligação e técnicas de cromatografia. [8]


Cartão Tox: Efeitos Cardiovasculares de Drogas sobre o Potencial de Ação e ECG

Authors: Todd Duppong, MD (PGY2, Emergency Medicine Residency Program, Morristown Medical Center), Cynthia Santos, MD (Assistant Professor Emergency Medicine, Medical Toxicology, Rutgers NJMS) // Edited by: Alex Koyfman, MD (@EMHighAK, EM Attending Physician, UTSW / Parkland Memorial Hospital), and Brit Long, MD (@long_brit, EM Attending Physician, San Antonio Military Medical Center)

A 35 year old lady intentionally overdosed on her prescription medication for fibromyalgia and recent diagnosis of depression. ECG shows sinus tachycardia (rate of 150), QRS ≥120 ms, and R wave elevation in aVR ≥3 mm. What are the action potential phases responsible for ECG changes? What ECG changes are associated with cardiotoxicity? Which medications cause changes in action potential/ECGs?

Fundo:

An electrocardiogram (ECG) is a rapid diagnostic tool frequently used for evaluation because of the predictable cardiotoxic effects from specific drugs. Serial ECGs should be performed in addition to a good history, physical examination, and evaluation of clinical findings/toxidrome to guide course and treatment.

Figure 1: Represents ECG and time associated action potential phases.[1]


Potassium Channel Blockers (Class III Antiarrhythmics)

The main drug is amiodarone, which is most commonly used as antiarrhythmic. It is effective in a wide range of arrhythmias.

Chemical Nature

Resemble thyroxine, having properties of class 1, II and IV drugs.

Mecanismo de ação

It mainly acts by blocking K+ channels. It increases the refractory period. It increases the duration without effecting phase 0 and resting membrane potential.

There are two types of K+ channels:

Inward potassium current or rectifier also called delayed potassium currents. 2 components are:

The drug acts mainly by blocking IKr. Chronic administration also affects I Ks , It blocos K+ channels. Also have some effects on alpha and beta receptors, blocking them non-competitively, having a small effect.

Farmacocinética

Drug is rapidly absorbed after oral route of administration. It has high volume of distribution (greater tissue binding). Since it is highly lipid soluble, it tends to deposit in the tissues, especially adipose tissue. It is metabolized in the liver and excreted in bile. It is slowly released from the tissue binding sites. Half life is longer (about 30 days, may even be up to 100 days).

Usos
  1. Drug has broad antiarrhythmic effect (esp. ventricular arrhythmias)
  2. Supraventricular arrhythmias
  3. Reentrant tachycardia –as prolongs refractory period.
Adverse Effects

Since the drug causes prolongation of refractory period

  1. QT interval is prolonged
  2. Because of resemblance with thyroxine, drug may interfere with functions of thyroid, causing hypo or hyperthyroidism.
  3. As has greater Vd, it gets bound and deposited in cornea, leading to visual problems and photophobia.
  4. Has tendency to deposit in skin, may sensitize it to sunlight. Bluish discoloration occurs on exposed parts on prolonged administration (due to iodine content).
  5. On prolonged administration pulmonary fibrosis might occur
  6. Hepatic damage might occur as is metabolized in the liver.
Interações medicamentosas
  1. With digoxin, plasma conc. of digoxin increases
  2. Warfarin, similar to digoxin
  3. With beta blockers and Ca++ channel blockers –both cause depression of heart, causing hypotension and bradycardia.
Dose

Start at loading dose, first given 200 mg for 1 week (twice daily). Maintenance dose is 200 mg once daily.

Bretylium

Bretylium is adrenergic neuron blocker and sympatholytic drug. It acts by inhibiting release of NE from adrenergic nerve terminals. It is mainly used for treatment of refractory ventricular arrhythmias esp. after MI and during surgery.

Sotalol

Sotalol is a beta blocker with class III properties. It prolongs the refractory period and action potential. It is commonly used.


Assista o vídeo: Membranpotensialet (Dezembro 2022).