Em formação

Projeto de primer para montagem Gibson

Projeto de primer para montagem Gibson


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estou tentando projetar uma cartilha para a montagem Gibson. Meu gene de interesse está em um plasmídeo e quero copiar esse gene e colocá-lo em um plasmídeo diferente.

Não tenho certeza de como projetar meus primers para PCR. Eu sei que preciso de 2 conjuntos de primers (4 no total).

  1. Iniciador para trás e para a frente para copiar meu gene do plasmídeo que o contém.
  2. Primer para trás e para a frente para copiar o plasmídeo.

Também sei que preciso criar regiões complementares de sobreposição entre meu gene e o plasmídeo em que desejo colocá-lo. Como faço isso?

Aqui está o plasmídeo e o gene. Quero colocar o gene entre o prefixo e o sufixo do biobrick.

Aqui estão os primers que acho que preciso:

Para o plasmídeo em que desejo colocar o gene, meus primers devem ser

  • Avançar:ATTCGCGGCCGCTTCTAGAG
  • Reverter:CTGACGCGGCCGCTACTAGTA

Primers para copiar o gene e adicionar sobreposição

  • Reverter:ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Avançar:AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Aqui está o gene

Aqui está o plasmídeo em que quero colocá-lo. Estou usando geneious, mas acho que, para esse propósito, a palavra funciona bem.


Isenção de responsabilidade: eu nunca fiz uma montagem Gibson, mas aqui está meu entendimento teórico de como projetar seus primers. Você precisa de quatro 40mers, cada um consistindo de segmentos de 20 bp derivados do vetor e da inserção e correspondentes às junções que você está tentando criar. No diagrama abaixo, as linhas pontilhadas representam as junções entre os dois segmentos de 20 bp de cada 40mer.


Aqui está uma boa visão geral das considerações de projeto de primer ao usar a montagem Gibson. http://j5.jbei.org/j5manual/pages/22.html


Projeto de primer para montagem Gibson - Biologia

A ferramenta projeta primers com 60 nucleotídeos (nt) de comprimento. Cada primer inclui 20 nt de sequência específica do gene para o recozimento do molde e 30-40 nt de sequência de sobreposição, que será usada para gerar sobreposição homóloga entre dois fragmentos adjacentes.

Sequências homólogas de 40 pb

A Gibson Assembly® Primer Design Tool irá gerar primers usados ​​para adicionar sobreposições homólogas a fragmentos, permitindo uma montagem eficiente. Os iniciadores são fixados em 60 nucleotídeos de comprimento e incluem 20 nucleotídeos da sequência específica do gene para o recozimento do molde. Entre o vetor e a junção de inserção, você pode incorporar um motivo de sequência, de até 10 nt de comprimento, para permitir a digestão de restrição. Como resultado, 30 a 40 pb de sobreposição homóloga podem ser gerados após a amplificação por PCR. O tamanho da sobreposição é suficiente para suportar uma montagem de fragmento de até 10 kb, ou até 15 fragmentos com inserções de até 1 kb cada. Estender a sobreposição homóloga é recomendado para a montagem de genes grandes.


Visão geral da montagem Gibson

A técnica de montagem Gibson foi descrita pela primeira vez pelo Dr. Daniel Gibson e colegas do J. Craig Venter Institute em 2009. Aqui na Addgene, adicionamos esta opção ao nosso menu suspenso de opções comuns de clonagem no processo de depósito em 2014 por causa de seu ganho em popularidade. A montagem Gibson é bem conhecida por permitir a fácil montagem de vários fragmentos lineares de DNA, mas também pode ser usada na clonagem básica de uma inserção em seu vetor de escolha, conforme mostrado na figura abaixo. Para começar, você precisa ter fragmentos de DNA com regiões de homologia em suas extremidades, que são normalmente criadas por PCR. Em seguida, os fragmentos são incubados junto com uma mistura principal de enzimas, que contém três enzimas diferentes:

  • uma exonuclease, que mastiga as extremidades 5 'do fragmento, gerando saliências longas que permitem que as regiões de fita simples com homologia se recozam
  • uma polimerase, para preencher as lacunas
  • uma ligase de DNA, para selar os cortes das lacunas recozidas e preenchidas

A grande parte dessa mistura de enzimas é que todas elas podem funcionar na mesma temperatura, de modo que toda a reação leva uma hora ou menos para ser concluída a 50 ° C. Depois de mais ou menos uma hora, a amostra está imediatamente pronta para se transformar em células competentes. A mistura principal de enzimas pode ser adquirida de uma empresa (por exemplo, NEB ou SGI-DNA), ou pode ser misturada você mesmo (por exemplo, consulte o Miller Lab Protocol). O processo de montagem Gibson pode ser usado para montar até 6 fragmentos em uma etapa, resultando em montagem sem cicatrizes que não requer a presença de locais de restrição específicos (ou a falta deles), nem um sério comprometimento de tempo. Outra vantagem é que este processo torna mais fácil gerar construções de tipo selvagem e mutantes ao mesmo tempo, em vez de sequencialmente.


A montagem de Gibson é uma forma popular de inserir fragmentos em um plasmídeo sem o uso de enzimas de restrição. Para simular esse método, o SnapGene oferece uma interface intuitiva.

Para a montagem Gibson, o PCR amplifica os segmentos de DNA para criar extremidades sobrepostas. Em seguida, incube os produtos amplificados com enzimas de montagem e transforme a mistura em bactérias.

O SnapGene simplifica a montagem Gibson automatizando o projeto do primer. Para planejar uma reação de montagem Gibson, basta selecionar os fragmentos de DNA que deseja unir e o SnapGene escolherá os primers adequados.

Estes sites fornecem mais informações sobre a Assembleia Gibson:

“O SnapGene nos ajudou muito no planejamento de nossas montagens Gibson e etapas de clonagem de restrição, bem como no design de nossa coleção premiada de promotores. Acho que não houve um dia em que não usássemos o software. ”


Clone usando o Gibson Assembly Wizard

Para acessar o Assistente de Montagem, primeiro abra um arquivo de sequência. Na parte inferior da tela, você encontrará o Assistente de Montagem ao lado de Dividir o Espaço de Trabalho. Clique em Assistente de montagem e selecione Criar nova montagem. Nas opções fornecidas, selecione Gibson e pressione Iniciar para prosseguir com a montagem.

Abra uma sequência de backbone e clique no slot de Backbone. Para linearizar a sequência do backbone com um local de corte de enzima de restrição, clique no local de corte, segure a tecla Shift e clique novamente. Pressione Set Fragment para definir o backbone.

Abra sua próxima sequência de inserção e clique no slot de inserção. Selecione todas as bases da pastilha. Pressione Set Fragment para definir a primeira inserção.

Pressione o botão + à direita do assistente de montagem para adicionar outra inserção. Abra a próxima inserção e clique no novo slot de inserção. Novamente, selecione todas as bases da pastilha. Pressione Set Fragment para definir a segunda inserção.

Se você deseja adicionar uma sequência espaçadora como "kozak" entre quaisquer 2 inserções, clique no botão Adicionar espaçador após. Nomeie o espaçador “kozak” e defina suas bases como gccacc. Pressione Salvar para definir a sequência do espaçador.

Quando a montagem estiver concluída, renomeie a montagem com o nome de construção desejado e pressione Montar à direita do assistente de montagem.

Selecione o local da pasta desejada para a pasta de sequência e a pasta de primer. Pressione Criar para concluir a montagem.

Abra a construção recém-montada e clique no painel de histórico para visualizar a linhagem da sequência. Observe que o backbone e os fragmentos de inserção na sequência montada são coloridos.

Abra a guia Montagem para ter uma visão geral da montagem, imprima-a ou exporte os primers.

Se você substituir qualquer uma de suas sequências no local de ligação do primer, o Benchling atualizará automaticamente o primer e exibirá a mutação na guia Assembly's Mismatches Introduced table.

Para ativar o alinhamento à sequência montada ou fazer edições arbitrárias nela, abra a guia Montagem e pressione Finalizar no canto superior direito.

Nota: O assistente de montagem não espera que os braços de homologia sejam incorporados ao backbone / inserção, pois eles são simplesmente concatenados.


Referências

Hughes RA, Ellington AD. Síntese e montagem de DNA sintético: colocando o sintético na biologia sintética. Cold Spring Harb Perspect Biol. 20179 (1): 1-17.

Ellis T, Adie T, Baldwin GS. Montagem de DNA para biologia sintética: das partes às vias e além. Integr Biol (Camb). 20113 (2): 109–18.

Cobb RE, Ning JC, Zhao H. Técnicas de montagem de DNA para biossíntese combinatória de próxima geração de produtos naturais. J Ind Microbiol Biotechnol. 201441 (2): 469–77.

Chao R, Yuan Y, Zhao H. Avanços recentes em tecnologias de montagem de DNA. FEMS Yeast Res. 201515 (1): 1–9.

Juhas M, Ajioka JW. Montagem de DNA de alto peso molecular in vivo para aplicações de biologia sintética. Crit Rev Biotechnol. 201737 (3): 277–86.

Liang J, Liu Z, Low XZ, Ang EL, Zhao H. Montagem não enzimática de DNA de primer duplo: um método de montagem de DNA multipartes eficiente e preciso. Nucleic Acids Res. 201745: e94.

Jin P, Ding W, Du G, Chen J, Kang Z. DATEL: um método de montagem de DNA sem cicatrizes e independente de sequência usando exonucleases termoestáveis ​​e Ligase. ACS Synth Biol. 20165 (9): 1028–32.

Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Montagem enzimática de moléculas de DNA de até várias centenas de quilobases. Métodos Nat. 20096 (5): 343-5.

Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden gate shuffling: a one-pot DNA shuffling method baseado em enzimas de restrição do tipo IIs. PLoS One. 20094 (5): e5553.

Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, Vaiskunaite R. Engenharia de DNA amigável ao USUÁRIO e método de clonagem por excisão de uracila. Nucleic Acids Res. 200735 (6): 1992–2002.

de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB, Serber Z, Dean J, et al. Montagem rápida e confiável do DNA por meio da reação de ciclagem da ligase. ACS Synth Biol. 20143 (2): 97–106.

Shao Z, Zhao H. DNA assembler: uma ferramenta de biologia sintética para caracterizar e criar agrupamentos de genes de produtos naturais. Methods Enzymol. 2012517: 203–24.

Li MZ, Elledge SJ. Aproveitar a recombinação homóloga in vitro para gerar DNA recombinante via SLIC. Métodos Nat. 20074 (3): 251–6.

Zhang Y, Werling U, Edelmann W. SLiCE: um novo método de clonagem de DNA baseado em extrato de célula bacteriana. Nucleic Acids Res. 201240 (8): e55.

Tillett D, Neilan BA. Clonagem livre de enzimas: um método rápido para clonar produtos de PCR independente dos sítios de enzimas de restrição do vetor. Nucleic Acids Res. 199927 (19): e26.

Stevenson J, Krycer JR, Phan L, Brown AJ. Uma comparação prática de técnicas de clonagem independente de ligação. PLoS One. 20138 (12): e83888.

Garcia-Nafria J, Watson JF, Greger IH. Clonagem IVA: um sistema de clonagem universal de tubo único que explora a montagem bacteriana in vivo. Sci Rep. 20166: 27459.

Liu CJ, Jiang H, Wu L, Zhu LY, Meng E, Zhang DY. Clonagem OEPR: uma estratégia de clonagem eficiente e perfeita para fragmentos grandes e múltiplos. Sci Rep. 20177: 44648.

Zeng F, Hao Z, Li P, Meng Y, Dong J, Lin Y. Um método sem restrição para reconstituição de gene usando dois PCRs de iniciador único em paralelo para gerar extremidades coesivas compatíveis. BMC Biotechnol. 201717 (1): 32.

Cherezov V, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, et al. Estrutura de cristal de alta resolução de um receptor acoplado à proteína G beta2-adrenérgica humana. Ciência. 2007318 (5854): 1258–65.

Ikeda H, Nonomiya T, Usami M, Ohta T, Omura S. Organização do grupo de genes biossintéticos para o macrolídeo avermectina policetídeo anti-helmíntico em Streptomyces avermitilis. Proc Natl Acad Sci U S A. 199996 (17): 9509–14.

Garrido LM, Lombo F, Baig I, Nur EAM, Furlan RL, Borda CC, Brana A, Mendez C, Salas JA, Rohr J, et al. Visão das etapas de glicosilação durante a biossíntese da antraciclina cosmomicina antitumoral: caracterização de dois genes de glicosiltransferase. Appl Microbiol Biotechnol. 200673 (1): 122–31.

Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS. Clonagem, sequenciamento e análise do cluster de genes de biossíntese de enterocina do isolado marinho ‘Streptomyces maritimus’: evidências para o descarrilamento de uma policetídeo sintase aromática. Chem Biol. 20007 (12): 943–55.

He J, Hertweck C. Iteração como evento programado durante a análise molecular de montagem de policetídeo do cluster de genes de biossíntese de aureotina. Chem Biol. 200310 (12): 1225–32.

Yurkovich ME, Tyrakis PA, Hong H, Sun Y, Samborskyy M, Kamiya K, Leadlay PF. Um intermediário de estágio avançado na biossíntese de salinomicina é revelado por mutação específica no agrupamento de genes biossintéticos. Chembiochem. 201213 (1): 66–71.

Dagert M, Ehrlich SD. A incubação prolongada em cloreto de cálcio melhora a competência das células de Escherichia coli. Gene. 19796 (1): 23–8.


Benefícios da tecnologia de clonagem de montagem GeneArt Gibson

Os kits EX de montagem GeneArt Gibson são ideais para a montagem de vários insertos.

Figura 1. Os kits de clonagem GeneArt Gibson Assembly EX fornecem opções de alta eficiência de transformação ao usar um grande número de inserções. Montagem de 6, 8 e 10 fragmentos de 0,5 kb em pcDNA 3.4 transformados em Invitrogen TOP10 Competent Cells.

Os kits GeneArt Gibson Assembly HiFi oferecem uma maneira econômica e eficiente de reunir um número menor de fragmentos. Para montagens maiores, estão disponíveis os Master Mixes e Kits GeneArt Gibson EX.

Figura 2. Os kits GeneArt Gibson Assembly HiFi fornecem alta eficiência de clonagem usando uma única inserção para vários designs de inserção. Montagem de 1, 2 e 4 - fragmentos de 1kb em pCDNA 3.4 usando células competentes TOP10. Os kits GeneArt Gibson Assembly HiFi são o método com melhor custo-benefício e economia de tempo para a construção de grandes montagens, particularmente quando usados ​​com GeneArt Strings DNA Fragments ou 100% sequenciado, Gene Synthesis GeneArt.


Como funciona a montagem Gibson

O uso da tecnologia do DNA recombinante começou logo após a descoberta da DNA ligase e das endonucleases de restrição. Logo depois, o advento da reação em cadeia da polimerase (PCR) abriu novas possibilidades para a amplificação de sequências específicas de DNA a partir de uma mistura complexa de DNA genômico. Essas tecnologias têm sido um pilar no laboratório científico moderno por várias décadas e continuam a ser métodos úteis para a clonagem de DNA potencialmente valioso ou interessante hoje. No entanto, conforme os cientistas buscam trabalhar com fragmentos de DNA maiores, realizar uma ampla reengenharia de elementos genéticos, sintetizar genomas inteiros e avançar para abordagens automatizadas, as tecnologias necessárias para manipular o DNA também precisam evoluir.

Os investigadores do J. Craig Venter Institute (JCVI) desenvolveram uma série de em vitro estratégias enzimáticas para montar oligonucleotídeos curtos em construções maiores de DNA de fita dupla (1-4). Em 2003, o JCVI fez um avanço significativo na produção de um genoma sintético ao montar o genoma de 5.386 pb de phiX174, um vírus que infecta bactérias, em apenas 14 dias (5). Esta abordagem envolveu a união de oligonucleotídeos sintéticos por montagem de ciclo de polimerase, e subsequentemente amplificando-os por PCR (5-6). A velocidade sem precedentes com que isso foi concluído lançou as bases para a construção de genomas maiores e mais complexos.

Em 2004, a JCVI começou a sintetizar o Mycoplasma genitalium genoma. Verificou-se que moléculas de DNA sobrepostas podem ser unidas de forma eficiente usando três especificidades enzimáticas: (i) atividade de exonuclease, que mastiga as extremidades dos fragmentos de DNA e expõe saliências de ssDNA que podem se anular ao complemento de ssDNA (ii) atividade da polimerase de DNA, que preenche lacunas nos produtos recozidos e (iii) atividade da DNA ligase, que sela covalentemente os cortes resultantes na montagem. Um termociclo baseado em duas etapas em vitro método de recombinação utilizando essas enzimas foi usado para juntar 101 cassetes de DNA sobrepostos em quatro partes do M. genitalium genoma, cada um entre 136 kb e 166 kb de tamanho. Este marco marcou a primeira montagem de um genoma derivado de um organismo de vida livre. Com 582.970 pb, esse genoma sintético era a maior estrutura de DNA quimicamente definida sintetizada em um laboratório e era 18 vezes maior do que qualquer DNA previamente sintetizado (4).

Desde então, mais dois em vitro métodos de recombinação foram desenvolvidos por JCVI para unir e clonar moléculas de DNA maiores que 300 kb em uma única etapa (2-4). O mais simples desses métodos é a montagem de Gibson, uma abordagem isotérmica de uma etapa que utiliza as mesmas três atividades enzimáticas descritas anteriormente. Este método pode ser usado para unir ssDNA e dsDNAs.

Figura 1. Visão geral da montagem Gibson.


A montagem Gibson tornou-se a mais comumente usada das em vitro métodos de montagem discutidos acima, pois é fácil de usar, flexível e precisa de pouca ou nenhuma otimização, mesmo para montagens grandes e complexas. Tudo o que é necessário é inserir o DNA com sobreposições apropriadas e uma mistura apropriada das três enzimas & ndash a Gibson Assembly Master Mix. Fragmentos de DNA são adicionados à mistura principal e incubados a 50 & degC por 1 hora, o produto de montagem resultante é um dsDNA totalmente selado adequado para uma variedade de aplicações a jusante (Figura 1). JCVI usou Gibson Assembly para sintetizar rapidamente todo o genoma mitocondrial de camundongo de 16.520 pb a partir de 600 oligonucleotídeos de 60 bases sobrepostos (3). Também foi usado em combinação com a montagem de levedura para sintetizar o 1,1 Mbp Mycoplasma mycoides genoma, que foi então ativado em uma célula receptora para produzir a primeira célula sintética (1).


Veja abaixo a versão consolidada.

Prepare mapas de plasmídeo

  • Faça um mapa de plasmídeo de como deve ser a aparência de seu projeto concluído
    • Essa é a chave. Você vai querer isso para design de primer, verificar seus primers, avaliar reações de sequenciamento, etc. Eu uso APE, um software de código aberto. Veja meus comentários de uso do APE em Dicas e truques.
    • Principalmente, isso significa copiar de outras sequências de plasmídeo e colar em um novo arquivo de plasmídeo.
      • No entanto, você pode adicionar itens mais curtos, como promotores e locais de ligação do ribossomo, codificando-os em seus primers.
      • Você também pode adicionar regiões mais longas de DNA usando oligos mais longos (90+ pb)
      • Você pode usar DNA genômico, geralmente de células inteiras (não há necessidade de purificar primeiro)
      • Certifique-se de que cada gene tenha um promotor, RBS e códon de parada, se desejado.
      • Se você não estiver familiarizado com suas sequências, certifique-se de que a sequência não tenha códons de parada no quadro com o início.
      • Inclua a sobreposição gerada pelos primers.

      Design primers

      • O design do primer é a chave. Se todos os PCRs derem um bom rendimento sem bandas indesejadas em todas as condições de termociclagem testadas, é muito provável que sua montagem funcione bem.
        • É sempre um bom sinal quando os primers trabalham em várias temperaturas de recozimento, distantes alguns oC, e além das concentrações de DMSO. Uma vez que a etapa de montagem é tão dependente da sequência do iniciador e da ausência de estrutura de DNA de fita simples (grampos de cabelo, etc.), a facilidade de PCR é um bom indicador para saber se a montagem provavelmente irá bem.
        • Se seu backbone não amplifica bem, ou amplifica com produtos colaterais e requer purificação de gel, você tem muito menos probabilidade de obter montagens bem-sucedidas. Se um PCR pobre for gerado, considere aumentar a temperatura de anelamento da região de ligação para o iniciador & gt 72 o C, e usar diferentes áreas do vetor para sobreposição, se possível.
        • eu sempre use primers com Tm & gt72 o C para a região de recozimento. Tm os valores devem sempre ser calculados pelo site da Finnzymes
          • Esta fórmula é aplicável à Phusion DNA polimerase, a DNA polimerase usada para criar o DNA que você vai montar.

          Verifique o seu design

          • Certifique-se de que os primers diretos e reversos que você está solicitando correspondem à direção pretendida.
            • Este é um erro fácil de cometer.

            Encontre as condições ideais

            Digestão Dpn1 do DNA modelo

            • Dpn1 geralmente deve ser adicionado após a conclusão da PCR para degradar o DNA molde. Isso reduzirá o número de colônias de fundo ao transformar. Normalmente não é necessário quando se purifica fragmentos em gel, no entanto, a purificação em gel deve ser evitada como aqui discutido.
              • Isso evita o transporte do modelo.
                • Se os modelos para seus PCRs são vetores de canamicina, e você está construindo um vetor de canamicina, então alguma fração de seus transformantes serão apenas células com o (s) plasmídeo (s) modelo (s) realizado (s). Isso precisa ser levado em consideração posteriormente, na etapa de triagem.
                • Se você tiver um fragmento de um plasmídeo Amp e estiver construindo um vetor de canamicina, não há necessidade de adicionar Dpn1.

                0,5 ng de plasmídeo modelo por 25 uL de reação de PCR para produzir meu backbone, depois purificado em coluna (não purificado em gel!), E não fez uma digestão com Dpn1. As colônias rosa são o molde do plasmídeo que passa pela purificação da coluna, até a reação de montagem e a etapa de transformação.

                Avisos

                • Seja extremamente cuidadoso ao usar a combinação certa de primers se estiver amplificando vários fragmentos de um plasmídeo ou se seus primers funcionarem em modelos usados ​​para uma montagem.
                  • Ex .: uma vez eu estava aparando um vetor e usei a combinação errada de primers para o backbone. A banda no gel parecia correta (a diferença de 400 bp em um backbone de 5 kb é sutil), mas leva a montagens com apenas uma das duas costuras sendo correta.

                  Faça o suficiente para purificar e montar

                  • Executar reações de escala de purificação para fazer DNA para montagem
                    • Se o seu produto é específico e não precisa ser purificado em gel: (só precisa de limpeza de PCR)
                      • 20uL de um inserto fortemente amplificado são suficientes. Faça um pouco mais (30uL) se for o backbone. Essas quantidades geralmente rendem bastante DNA para 5+ montagens, permitindo a possibilidade de várias tentativas.
                      • execute mais como 60-120 uL, dependendo de quão ruim são os subprodutos.

                      Purificar fragmentos de PCR

                      • A melhor maneira de purificar os produtos PCR é uma limpeza simples da coluna. Usamos o kit de limpeza PCR Qiagen e eluímos em água.
                        • Isso geralmente requer que seus PCRs sejam muito específicos para o tamanho de banda que você deseja. É por isso que os primers de PCR são feitos com temperaturas de fusão de 70 o C: fazer o anelamento em alta temperatura (67-70 o C) é a maneira mais provável de fornecer a amplificação de PCR desejada. Você precisa ter verificado
                        • Isso removerá dímeros de primer e bandas indesejadas. Infelizmente, os kits de extração de gel com base em coluna têm eficiência extremamente baixa. Você pode eluir em água ou no tampão fornecido pelo kit (presumindo que seja apenas Tris 10 mM, pH 8,5 e sem EDTA), mas sempre usei água.
                        • Eluir em 30 uL (não 50 uL) para fornecer um produto concentrado.

                        100 uL de produto de PCR geralmente rendem

                        Fragmentos de Nano Drop PCR

                        • Execute 1,5 uL em uma máquina NanoDrop para aproximar a concentração de DNA de cada eluato.
                        • Você pode usar o 1,5uL executado na máquina em um gel de agarose para confirmar que os produtos têm uma boa aparência e não foram misturados acidentalmente durante a purificação.
                        • Exemplo:

                        Reação de montagem Gibson

                        • adicione seus produtos de PCR purificados e adicione água para atingir a concentração desejada, conforme especificado pelo seu kit comercial ou receita caseira.
                          • O kit disponível comercialmente funciona

                          Transformação

                          • Normalmente, a eletroporação é usada, pois pode dar a você uma eficiência muito maior. No entanto, algumas pessoas usam células quimicamente competentes, o que pode ser suficiente se a montagem for mais simples. A quantidade de DNA que você transforma e se precisa dessalinizar primeiro depende da eficiência de montagem esperada e da toxicidade do produto.
                          • Dessalinizar o DNA por 15 minutos em filtros millipore significa que você pode adicionar mais DNA às eletroporações e não ter arco.
                            • Usamos papel dessalinizador Millipore, item # VSWP01300 para dessalinizar reações de 12-20 uL e Millipore # VSWP02500 para volumes maiores. Coloque todo o conjunto em cima de um filtro que está flutuando em cima da água.
                            • Aaron Puri aguarda 15 minutos de dessalinização e eletropora a 1,6 kV sem formar arco. -6/2015. Não há mal nenhum em deixá-los por mais tempo.

                            • Podem ser muito mais eficientes do que as células quimicamente competentes.
                            • Usar

                            • Se você usou a mistura de montagem comercial e seu projeto (a) não é muito complicado (muitas peças, muito grande de um produto final, muito tóxico de genes) e (b) é transformado em células eletrocompetentes muito boas (concentradas), então, 1-2 uL podem fornecer colônias suficientes para ter um gramado.
                            • Você pode querer transformar alguns un-fragmentos reunidos, para ter uma noção de qual é o pano de fundo na transformação real. (Algumas das colônias que crescem na placa de transformação terão DNA modelo, não a construção desejada, apesar da digestão Dpn1.
                            • Se você estiver plaqueando plasmídeos que conferem resistência à ampicilina, aplique carbenicilina e não ampicilina.
                              • A ampicilina é conhecida por fornecer colônias satélites ou mesmo gramados de bactérias não resistentes. Isso é especialmente um problema se o plasmídeo montado levar a um crescimento lento, pois as bactérias não resistentes terão muito tempo para florescer. Se suas células eletrocompetentes forem boas, a alta densidade celular provavelmente levará a um gramado de bactérias em uma placa de Amp, mesmo que a maioria das bactérias não seja resistente a Amp. Você poderia plaquear uma pequena fração de sua eletroporação no Amp, mas isso presume que você tem uma alta eficiência de montagem e um plasmídeo de baixa carga (por exemplo, promotor moderado + RFP, não promotor de alta força e várias enzimas).

                              Triagem: PCR de colônia

                              Use o PCR de colônia para gerar fragmentos de PCR que confirmarão sua montagem.

                              • Não use Phusion para isso, é muito valioso.
                              • Eu uso a mistura de PCR [2X OneTaq http://www.neb.com/nebecomm/products/productM0486.asp] por vários motivos:
                                • É barato
                                • Pode ser armazenado na geladeira, descongelado, por meses sem causar danos.
                                • Ele já tem o corante de carregamento, então o carregamento em géis de agarose para observação é acelerado.
                                • Gorjeta: Faça cerca de 1/2 mL de água e primers de PCR de colônia em proporções adequadas para a mistura 1x final. Veja esta planilha para proporções de mistura. Vá em frente e faça 1/2 mL, você pode ficar feliz por ter extra mais tarde e a água / primers são quase de graça. Você pode armazenar as sobras na geladeira indefinidamente. Eu rotulo o meu OneTaq 212 213 se eu misturar os primers 212 e 213. Então, quando você fizer PCR de colônia, você pode adicionar 6 uL desta mistura a cada poço, dissolver as células em cada poço, e adicione 6uL da mistura 2x por cima.
                                • Como alternativa, você pode fazer uma mistura 1x (adicionar a água e os primers necessários) e usar a mistura após vários ciclos de congelamento e descongelamento.
                                • PCR em uma região que é um comprimento diferente do que qualquer um dos seus plasmídeos modelo. Isso permitirá que você diga quais montagens são bem-sucedidas e quais são o modelo transportado.
                                  • Se você alterou um gene em um plasmídeo e o tamanho do gene é diferente, faça PCR para o comprimento dessa região.
                                    • Você pode fazer PCR em toda a inserção se inseriu em um vetor vazio e seus modelos não amplificarão para fornecer os mesmos tamanhos de produto.
                                    • Você pode decidir repetir as colônias testadas antes ou depois dos resultados. Eu sempre faço uma nova quebra de linha, com o objetivo de obter colônias únicas, para reduzir a probabilidade de meu miniprep ser uma população mista.
                                      • Eu pratico ao mesmo tempo que provo se:
                                        • Acho que a fração de sucesso (não o modelo) será alta
                                        • Estou executando o PCR durante a noite e não receberei os resultados até de manhã.
                                        • Acho que os resultados serão na maior parte transportados do plasmídeo modelo
                                        • Terei a oportunidade de executar os produtos de PCR em um gel antes de sair para o dia, permitindo-me apenas refazer os "vencedores".
                                        1. Decida quantas colônias você deseja filtrar. Prepare uma tira (ou tiras) de PCR com os poços numerados e correspondendo aos números da colônia.
                                          1. Eu uso conjuntos de 12, porque meus géis de agarose têm faixas suficientes para isso e duas faixas de escada. Você usará pelo menos um dos poços para amplificar o DNA modelo como um controle. Eu faço mais colônias (até 33-34) se espero que a realização do modelo seja um problema, ou se os genes são tóxicos e montagens bem-sucedidas tornam as células prejudiciais.
                                          2. Se você estiver quebrando todas as colônias testadas, prepare seus pratos agora. Eu divido o prato em 6 formas de fatias de torta.
                                          1. Se for replantar no início, marque também as áreas das fatias da pizza com esses mesmos números.
                                          1. Se você estiver rompendo colônias agora: limpe um pouco da colônia na placa e dissolva o restante no poço de PCR numerado correspondente.
                                          2. Se você não está rompendo colônias agora, tente deixar um pouco de biomassa na placa, mas tenha certeza de que sempre haverá células restantes, a menos que você realmente tenha feito um furo na agarose.
                                          3. É possível sobrecarregá-lo se você tiver colônias muito grandes e sugar muito com a ponta da pipeta.
                                          4. Assim que um determinado poço de PCR tiver a colônia dissolvida nele, ejete a ponta da pipeta no poço atrás dele. Além de ter cada poço numerado e as colônias numeradas e circuladas na placa de transformação, esta é uma proteção adicional para garantir que apenas uma colônia seja colocada em cada reação de PCR.

                                          Sequenciamento

                                          • Selecione 2-4 colônias para sequenciamento com base em PCR de colônia
                                          • Sequencie as costuras da montagem Gibson primeiro.
                                          • Sequenciar as outras regiões, pois é possível que um erro de PCR tenha sido introduzido
                                            • Normalmente, quando um "erro" é encontrado, ele estava realmente presente no modelo.

                                            Projetando primers para Gibson Assembly com MacVector 17

                                            O MacVector 17 possui uma ferramenta completamente nova para projeto automatizado de estratégias de clonagem independentes de ligase. A ferramenta suporta a montagem de Gibson conduzida por 5 'exonuclease, bem como a abordagem de "Clonagem Independente de Ligase" da T4 DNA Polimerase 3' exonuclease. MacVector pode projetar primers automaticamente quando você especifica fragmentos e vetores para usar. Você pode fornecer primers personalizados (manualmente ou de ferramentas como o site NEBuilder). Você também pode simplesmente fornecer fragmentos existentes com extremidades sobrepostas para MacVector montar. A interface mostra a estrutura exata das junções entre os fragmentos, incluindo traduções CDS relevantes para confirmar a estrutura das fusões de proteínas. A estratégia de clonagem pode ser salva como um novo documento de projeto de clonagem e, finalmente, montada automaticamente em uma única sequência para exportação.

                                            O MacVector 17 foi lançado em fevereiro de 2019. Ele contém ferramentas totalmente novas para comparar genomas, tornando a clonagem de enzimas de restrição mais fácil, design automatizado de estratégias de clonagem Gibson / LIC, destacando problemas de montagem, comparando conjuntos de dados de sequência múltipla contra uma única referência e tornando ainda mais mapas de plasmídeo bonito, exibindo seus próprios sites de ligação de primer! Finalmente, o MacVector 17 é compatível com o modo escuro do macOS Mojave para ajudar na concentração nas sessões noturnas de design de primer!


                                            Dados de desempenho

                                            Veja como o NEBuilder HiFi supera o NEB Gibson Assembly.

                                            Maior eficiência e precisão

                                            Fidelidade aprimorada

                                            Um ou mais desses produtos são protegidos por patentes, marcas registradas e / ou direitos autorais pertencentes ou controlados pela New England Biolabs, Inc. Para obter mais informações, envie um e-mail para [email & # 160protected]. O uso desses produtos pode exigir que você obtenha direitos de propriedade intelectual de terceiros para determinados aplicativos. .

                                            GIBSON ASSEMBLY & reg é uma marca registrada da Synthetic Genomics, Inc.